Description :
From Genome Similarity Track
Location :
contig_33:613- 4556
Transcript NameFunction/comments
g6432.t1hypothetical protein

Sequence
3943 bases(100 bases per row)
GTCGCACTCTGTTGTACGAGATGGGGTGCCGTACGCGTCTAACATGGTCGGTTGGCCGTCACTTTAACGCAGGGACAATATGCGATCAATGGTGGCTGCG
CGGCGGAGCATTCTTGTGAACAGCGGCCTTGACCTGGGAGACATCTTTGTGCAGTACGATTCTCACCGCACTGGGTTCGTGTCTCGATCGATGTTCGCCA
CTCTCTTGCGAGACTACAGCATTTCCATGCCGGAGACCACGCTACACTTCCTGATGATCCAGCTTGCGAAGCCGTCAGACACGACGTCTGTTTCGTACGT
GCGCTTCCTCGAAATCACGGATGTAGGAGTTGCAAGGAGCGCTTCAGCGAACCCACCGCTCAGCCACGGACTGGAGAACTCCCCGGCTCGCTTCAGCAGT
TGGACGAGTGGCCGGTAAGGATTCTATCATTGAGGATGAAAATTAAGACGCTCATCGTTTCATGCTCGTGGGTCTTGCTTTGTGTGTGACAGATCCAACC
CGTTCGAGCAAGAAAGTGCCGCTCGAGGTTATGCGATGCAAAACGCGTTCCTGTAGCTACTCAACCCGCCAGAGTTGTGAACCATGCGTCAGCGAGCCCC
GAGTTCGCAACACCTTTGCTCAGACTTGGATGGGTCTGTCGAGTGTGCGCACACCAGCAGATAGTAGATTGGGCCACTCACTGTGAAATTTGTGAAACAT
CAAAACCGCGGCCAGGCTACGCGGCGAAGGGTATATCAAATGCTTGCAGTGCAAGTTCGACAATAACTACGACATGGAGGAGTGTGAAATGTGTGGGCGT
CCACTCAATGCAAGTAACAAAAAGATGTCGAAATCAGAGAAGAAGCGCAGATCGAGAAAGCGCTACGTCTCAAGCTCTTCGTCGAGTTCTCCGTCTTCAT
CCTCTTCTTCAAGTTCATCGGGCCATCGCCGAAGTAGCAGGCGCAAATTCGAAAAGCAGTCCCGCTCGGCTCGATCAAGTCGAAAGAAAGAAGAGAAGAA
GCCGCGGTTTCAACGAGGCGAGGAAATCCAAGCCATTCCTCTCGGCAGAAGAGGTTATGAGATCGGGTGATCGCACGCGTCCGGCCCAATGGTACGTATG
ACATTGAGTTTGACAGCGGCCTTTACGAGAAGAACGTCGAGGAAGACTGCGTCCTCGAGATTTCACGTGCGCGCGTTATCAAGGCCAAAGACTTATCCGA
CAGCGAGGAAACTAAGCCGAAAGCTAAATGCTCCGATGACGACAATGATCCTGGGTACGAACCAGGAGATCGAGTCGAGGCTCGTTTTCAAGGCAATGGA
CGCTTCTTTGCTGGTACAATCAAGAAATGCAGAACAGGCGGATTGTATGATATCGAGTACGATGACGGTGAAGTTGAGCTTCGCGTTCGTTCGAAGTACA
TTAAGCGCGAGGAGGCGAAGAATCAGCGGAAGCCTTCTCCAAAAGAAGATGACGTATCTACCTCTGAAGTGCCGTGGGCTAAAGGACAGAAGGTAGAAGC
CAAACTGCGTGGGTGCACAGACTACGTGAGATGCGTCGTATTTCACGCAAATGCAGATGGCAGTTGTGACGTGGAGCTTGACACTGGTGAGCTGGAAAAA
CGAGTTCCGGGAAGAAACATTCGCGCCCGTGTGAGCTCGCCAATAAAAGCGAGGCCTACCGTCCAAAGTGAAGAGGAACCAGTCCGACCAAAGAGACCCT
TGGTGAAGAGGCCTAGTGCACCTTCCACAAGTGAGGATTCGTGTGCCCAGCCTAAATGGAGGTTCAAGCAAGGCCAAGCTGTCGAAGCAAAGCCTAAGGG
AAGAGATGGATATTTCCCCGGCGTAATTGCTAGATGCCGCTTGAATGGCTCCTATGACATTGATTTTGACGACGGAGAAAAAGTATTAGCAGTATCAGCC
ATCACCGTCCGCGCTATCGAAACAGCACCCGCTGCCAAGAAGACAACAACTACGCTTCACAGGAATCACTCAAGGCAACCATTGATTTCAAAGTTGGCCA
ACCAATTGAAGCCCAGTACAAGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTACGACATCGACTACGACGACGGCG
AGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGCGGTGGGCAAGAAGGGCGGCGCTGACAGCGACGACGGCCCGAAGCAGAAGAAGTTCAAGGAGGGC
GACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTACGACATCGACTACGACGACG
GCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGGCGGCGCTGACAGCGACGACGGCCCGAAGCAGAAGAAGTTCAAGGA
GGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTACGACATCGACTACGAC
GACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGGCGGCGCTGACAGCGACGACGGCCCGAAGCAGAAGAAGTTCA
AGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTACGACATCGACTA
CGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGGCGGCGCTGACAGCGACGACGGCCCGAAGCAGAAGAAG
TTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTACGACATCG
ACTACGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGCGGCGCTGACAGCGACGACGGCCCGAAGCAGAAG
AAGTTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTACGACA
TCGACTACGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGCGGCGCTGACAGCGACGACGGCCCGAAGCAG
AAGAAGTTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTACG
ACATCGACTACGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGGCGGCGCTGACAGCGACGACGGCCCGAA
GCAGAAGAAGTTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACG
TACGACATCGACTACGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGCGGCGCTGACAGCGACGACGGCCCG
AAGCAGAAGAAGTTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCA
CGTACGACATCGACTACGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGAGCGGCGCTGACAGCGACGACGG
CCCGAAGCAGAAGAAGTTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAAT
GGCACGTACGACATCGACTACGACGACGGCGAGAAGGAGACGG