Description :
From Genome Similarity Track
Location :
Scaffold_80:61293- 63182
Sequence
1889 bases(100 bases per row)
CCCGTTACACCTGGTAGCACGTTGTAGTCCTTCCAGCGACCACGACCACCTCATCTGATATGAACATGTTGGATGAGGAGGATAGCTTTCACGCCACGCG
TGAAGGATTTCCCATTTGAGTGACATCGAATGAAGTTCGGTAGAACGTATGAGTTCTACCGTAGGCGAAACCGCCATTAGCGCCATGTTGGAGTCTTTTG
ACAGAGACTAACAACATGCCGCTATAGCCAGGTTCATTCAAAATGAACTTGTCTCCGAAAGAGATAAAGTAGCCTTGCTTCACCAGCAAGGCTCTCAACA
GGCCGAGCCGTTGAGAGAACTCGGTCTCAACAGACAGAGCTGTTGAGACAGCAGTAATTCAATGCTGCTGTGGGCGGGACGACACATACGCGTCGTCCCG
AAATCTTGAAGGTTGATATCTCCAAGTACGGAGGAGTCGAGGAAGACTCCCTGTTATTATGGTTCGTCGAACTAGACAGAGCCATAAAGGCACGCCGTAT
CGACGATGAGCAAATGAAACTCACATATGCTCAAACCCACTTGGCGGGACGTGCCAAAACTTGGGCCTTAGGGCTGGAGATGAGAGACCCATATGCTTTT
GGGTCGCTGGAAGCCTTTAAACTCGACTCAAACAGACGTTTGAGCCACCACGGGCTGAGTTCAGGGCTCGATCAGAGCTTCCGAAACCCAAGCAGGGTAA
GCGTAATGTGCACACTTACACTGACACATACGACTCTCGCGAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCAAGAGAC