Description :
From Genome Similarity Track
Location :
Scaffold_60:61261- 62842
Transcript NameFunction/comments
Aphas_H257_14820transmembrane protein, putative

Sequence
1581 bases(100 bases per row)
ATGTTGACGGGTACGCCGAAGCAAAATCTCCCAAGGACCTGGAAGGGGGGGCGCTGGACTTGTTCTCGCGCGAAGCGTTTGCCCTCTTCATGCAGTACGG
CGCCATCGGGATCATCTACGGCATGATCCCGTCGCTCAACTACCCCATCTTCAACATCTACCTCAACTTGGAGGGGAATCAAACGTCGTCGTACGGCGTG
CTCACCGTGATCGGGTGGTCGTTCAAGGTCATCTTTGGCCGTTGTCGGATTGCGTCCCCATCTATGGCTACCGTCGGAAGTCGTGGATGTTGATCGGGTG
GACCATCACAATGATCTGTCTGAGTGTGATGGCGTTTTCGCCGTTCGGCGAGCCGTTTTGCAACCGCGAAAAGACCAAGTTTTGCAGCACGCCGTTGGAA
AAGGTGCCCAAGTCCGAGCTGCAGTACTTTAACTTGACCGCCCCCGACAACGGCACGCTGTTCATCCTTCTGTCTATGTTTATCGCGTTTGGATACGTCT
TGGCTGCGAGTGCGTCAGACGCGATGGTGGTCGAGTACGCCCAGCGAGAACCCGTGGCCATCCGCGGCCGCATCCAAACCGCCATCTACACCGTGCGTGA
GCTCACTGGCATCCTCGCGTACTTGGTAACTGCGTTCGGGCTGAATGGCCCCAACTACGCCGGGTCGTTTTCGTTTGCGTTGTCGCCGAATGCTCCGTAT
GGCATTTGCTTGGTGCCTTGTGTGCTGGTAGTGCTCTCGACGGTATTCTTGCTTGTGGAGAAGAAGACTGAGCCTTCGTCCTTCATCCTATGGTGGGGCA
CGTTTTGGGAATCTCTCCAGAGTCGCGTGACGTGGCAAATCTGTTTGTTCCGATTCGTGAGCAACGTGTTTCAGGGCGTCCGCACCACTGCGGGTTTGCC
CGTCTCGACGTACTGGGCGGGGGTCGAACCTCTCAACGATTCGCTCTCGAGCATCATTGGTAGTTTGATGTTTGCTGGTATTTTGGTGGTTGTGGGCAAA
TGGGGGCTTAACTGGAACTGGCGCTGGACCATCACCGCAGGTACCCTCGGGATGATCATCATCGACGGCTTTGTCGTGTACATGACCATCTGGGACGTCG
TGCGCAACCAGTGGTTTTTCACGGGTATAGCGTTGGCCGACAATATTCCCCACGGCATCCGCTTCATCGTGTCCACGTACGTGGCCGTCGAAATCGCCGA
CAAGGGCAACGAAGGCGCCATTTATGGCCTTGTGTCCACTGTGAACAACCTCGCGGGGCCGTTTGCCAGGATATTTTACAAGTACATCAACTCGTACTTC
AAAGTCCACCAGAACGACATCAAGTCCGACACGCTCGAGGTGCGGTGGGACGTCGCGTACGTGTACATGATTTCGTACGGGTTCAAAGTGGCGTCGTTGT
TTTGGCTATTTTTGCTGCCTCGCCAAAAGGCGGAAGTCTAGGCGTTAAAGGCGCGTGGTGGCAAGAGCAAAGTGGCGGGGGTGATCCTCGTGGCCACGTT
TGTCGCCTGCGTGTCGTTCGCCGTGACCAGCAACATCATGTCCATCTTCCCCTCGACCAAGTGTTACCGGATCGCAGGGGG