Description :
From Genome Similarity Track
Location :
Scaffold_885:6126- 8240
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_885-snap-gene-0.6Myosin

Sequence
2114 bases(100 bases per row)
GGCATTGACGACATGATCGCATTGAACTACCTGCACGAAGCTGCGATTCTGTACAATGTCAAGAAGCGCTTCCTCAAGCGACTGCCGTACACGTACACGG
GTGAGATCTGTATCGCCGTGAATCCATACCAGTGGCTTCCAGAGCTATACGCGGAAGACATTCATGCTCAGTACCTGACAAAGAGCCGTGACGAGCTGCC
ACCACACGTGTATGCGACGTCCGTTGCATCTTACAACGACATGCGGCGCAATGCGATGAACCAGTCGATTTTGGTGAGTGGCGAATCTGGCGCGGGGAAA
ACCGAGACGACGAAAATCTTGATGAACCACTTGGCGTCGATTGCCGGAGGTCTCAATGACACGACGATCAAGAAGATTATCGAAGTGAACCCGTTGCTTG
AGTCGTTTGGTAATGCGAAGACAGTGCGAAATGACAACAGTTCGCGTTTCGGAAAGTTCACGCAGCTGCAATTCGACAACCACGGGATCCTCGTTGGCGC
GAGGTGCAGGACGTACTTGCTCGAGAAAACGCGCGTGATCCACCACGAGTTCCCCGAGCGCAACTACCACATCTTTTACCAGATCCTCGAGTCGTCAAGC
GCACCGCACTGGTTCCTCGATAACAGCAGAACCTACAGGTACACTGGCGACAACACTCCAATCAAGATTGAAGGCATCTCTGATGCGTCGCACTTTGAGC
GAACGAAGACTGCGCTCGAACTGATTGGACTCAACAACGACGAGCAAGAAGTACTTTTCGGAGTGCTCGCAGGTATTTTACACCTGGGAGAAGTGCAATT
CCACGTGAAGAACGGCAACGATGATGAGTCCGTGATTGCTCCAAACGACGCGGGAACTGTGGCGGCGACGAAGCTGCTTGGAGTATCTGTAGACGAGCTG
GAAACCGCATTGTGCTCGCGAAAGATTGCGGTTTCTGGTGAAATTCTCACCAAATTCCTCCGCAAGGAGCATGCTGAAGAGTGCCGTGATGCGTTGGCGA
AGGCTATCTACTCAAACATTTTCGACTGGCTCGTGTCGATCATCAACATTTCGCTCGAGAACGACAAGCAGATGCGCAACCAAGTTGGAATTCTCGACAT
TTTCGGGTTTGAGCACTTCAAGCACAACTCGTTCGAGCAGTTTTGCATCAACTACGCGAACGAAAAGCTGCAGCAAAAATTTACACAAGACGTGTTCAAG
ACTGTGCAGATCGAGTACGAAGCGGAAGGCATCATGTGGAGCCACATCGAGTTTGCTGACAACCAAGAGGTGATTGCGATCATTGAAGACCGACTGGGTA
TCATTTCGCTCCTGAACGACGAAGTCATGCGACCGAAGGGCAATGACGAGTCACTGGTCTCGAAGCTCACTTCTATCCACAAGGAAGACAAGCATGTCAT
CGAGTTTCCAAGAACCTCGCGAACCCAATTTACAATCAAGCACTATGCGGGAGCAGTGCTGTACGAGTCGCTCGGTTTCTTGGAAAAGCACAAAGACGCT
TTGCTTCCGGATCTTTCCGATTTGATGCGAGGGTCGTCGAAAGCATTTCTCAGTGGGATTTTTGCTGTCAAAGACCCAGTTGAGACTGTTCCGCAAGTGA
ACCGCGGCGGCAGTGCTAGGAAGCCTCGCGCTGTTGGCGGACGAGCGACTGGAGGCGCGCTCACAGTTGCAAATGTTGGCACCCAGTTCAAGGACAACCT
GAATGAACTGATGACGAACATTCGGTTGACCAAGGTACACTACGTTCGCTGTATCAAGCCAAACCAGAAGAAAAGCCCTCACGAGATGGACCAGCCCATG
GTCGTGGCGCAGCTGCGTTGTGCTGGTGTGATCGAAGCGATTCGCATTTCTCGCGTTGCGTACCCGAACCGACTTCTTCTTGAAGAGCTTTTGGAGAAAT
TTTGGGCGTTTGACAAGCACCGAAAGAGCGACGTTCCTCTCGCAGACCGATGTGAAGCGGTGATGAAAAAGTTGAGCTTTTCATCTCCGAGCCAGTACCA
AATTGGTCGCACGCGAATTTATTTCCGCTTCGGAGTGCTGGAAGAAATGGATGACAAGAGAGCAGAGAGTGTGGATGTTCAAGCGCGTCGTCTCCAGTTC
CTCATGAAAGGCTT