Description :
From Genome Similarity Track
Location :
Scaffold_24:612587- 613730
Transcript NameFunction/comments
Sapdi_VS20SDRG_08192hypothetical protein

Sequence
1143 bases(100 bases per row)
GGGTGCAGACCGAGCTGGCCCGGCGACGGCTCGCCCGTGACTTCGCCAAAGTACAAGGCGAACGTGGCCTTGAGCTCTTCAATCTTGGCGCGGTCTTCCA
TCCACGTCTGGAACTCGAGCGAGTTGGCGCGCTTGATGTCCCAGGGCTGCACGCCGCTGGCCGGCGGCACGTCCGTGCGCGACGAGAAGCCGGCCATGAG
GCTCGACTGCACCTCCTTGGAGACGATCCAGTTGACAAAGAGCTTGGCCGCGGCCACATGCGGCGCCTTCTTGAGAATCGCAATGCGCTGGCCCCACGCG
AGGTAGTCGGACGACGCGTTGGCGCCCGTGATCTCCTTGATCGAGCTCGAGTTGGTCGCTGGCGCCGAGCCCGCGACGCCGATCGCCTTGCGCTGCGCTG
TCACCGCGAGGTCGGGCGTGTGCGAGCCGCGCTTGAACTCGATCTGCTGCGCCGCGAGCTTCTTGACCCAGTCCCAGCCGTACGCCTTGACGTAGCGGTC
GTAGACAAACAAGGTCGCATCGTCGTCGTGGGGATACGCGGACGCGATGAGACCCGCGTACTTGGGGTCGGCGAGGTCCTTGGCCGTCGCGGGGGCCGAA
AGCCCCTTCTTTTGCAATAGCGCCTCGTCGTAAAAGTAGCTAAACGTAAAGACCGCGTGCGAGAGCCAGTTGCCGTCCGGGTCCGTGAAACCCTTGTAGA
CGTCGCTGAAACCGTTGGGCTTGTACGGCAGGAGCTTGCCCTGCTTCTTCCAGCGCGGGTAGTCGTTGAGCGTCTGGAGCGCAACGACGTCCGCGACAAG
CGAATTCGTCTCGAGCTGGTTGTCGATGCGCACGTTGTGGTACTTGCTGTAGTCGACGACCATGGTGAGGTTCATCTTGGGAAACGCGGCGCGGAAGGCG
TCGGCCACGTAGTCTTGCTGCTGCGCGGTGTCGCCGCCGTGGTACACGACGAGGTTGCCGCCTTCCTTGAGCGCCTCTTCGTACAGCGTCTTGATCGACT
TGGTCTCTTCGTCATTGCCCGACGGCGGCGCCTTGGTCTTGCGGTACGCGCTCGCGTCTTCGAGCAGGAAGAGCAGCGGGAGAAGTGCAACGAGGCGGAA
GAGCTGCATGTTGGTCGTTGGAGTTGCTTTGGTCGATGCGAGG