Description :
From Genome Similarity Track
Location :
Scaffold_24:612584- 613700
Transcript NameFunction/comments
Sapdi_VS20SDRG_08192hypothetical protein

Sequence
1116 bases(100 bases per row)
CCCGGGTGCAGACCGAGCTGGCCCGGCGACGGCTCGCCCGTGACTTCGCCAAAGTACAAGGCGAACGTGGCCTTGAGCTCTTCAATCTTGGCGCGGTCTT
CCATCCACGTCTGGAACTCGAGCGAGTTGGCGCGCTTGATGTCCCAGGGCTGCACGCCGCTGGCCGGCGGCACGTCCGTGCGCGACGAGAAGCCGGCCAT
GAGGCTCGACTGCACCTCCTTGGAGACGATCCAGTTGACAAAGAGCTTGGCCGCGGCCACATGCGGCGCCTTCTTGAGAATCGCAATGCGCTGGCCCCAC
GCGAGGTAGTCGGACGACGCGTTGGCGCCCGTGATCTCCTTGATCGAGCTCGAGTTGGTCGCTGGCGCCGAGCCCGCGACGCCGATCGCCTTGCGCTGCG
CTGTCACCGCGAGGTCGGGCGTGTGCGAGCCGCGCTTGAACTCGATCTGCTGCGCCGCGAGCTTCTTGACCCAGTCCCAGCCGTACGCCTTGACGTAGCG
GTCGTAGACAAACAAGGTCGCATCGTCGTCGTGGGGATACGCGGACGCGATGAGACCCGCGTACTTGGGGTCGGCGAGGTCCTTGGCCGTCGCGGGGGCC
GAAAGCCCCTTCTTTTGCAATAGCGCCTCGTCGTAAAAGTAGCTAAACGTAAAGACCGCGTGCGAGAGCCAGTTGCCGTCCGGGTCCGTGAAACCCTTGT
AGACGTCGCTGAAACCGTTGGGCTTGTACGGCAGGAGCTTGCCCTGCTTCTTCCAGCGCGGGTAGTCGTTGAGCGTCTGGAGCGCAACGACGTCCGCGAC
AAGCGAATTCGTCTCGAGCTGGTTGTCGATGCGCACGTTGTGGTACTTGCTGTAGTCGACGACCATGGTGAGGTTCATCTTGGGAAACGCGGCGCGGAAG
GCGTCGGCCACGTAGTCTTGCTGCTGCGCGGTGTCGCCGCCGTGGTACACGACGAGGTTGCCGCCTTCCTTGAGCGCCTCTTCGTACAGCGTCTTGATCG
ACTTGGTCTCTTCGTCATTGCCCGACGGCGGCGCCTTGGTCTTGCGGTACGCGCTCGCGTCTTCGAGCAGGAAGAGCAGCGGGAGAAGTGCAACGAGGCG
GAAGAGCTGCATGTTG