Description :
From Genome Similarity Track
Location :
Scaffold_46:61224- 63148
Transcript NameFunction/comments
Aphas_H257_13057PREDICTED: anoctamin-8 isoform X3

Sequence
1924 bases(100 bases per row)
GCTGTTTCGAAATCGCCCGAATTCCCGCGTCGATGCCGTGCTGCGCGTGGGCGGGTCGTGGCTCGTGCTCGTGGTGTTGATGGAGGCGATCGTGCTGGCC
GTGGGCGCCGTCGCGCGGCTGTATGTGTCGCCGACGTGGGGCTACGCGCAAGGCAACATGACGCTCTTGGCGGGGTTGATCGTAGCGCAGATTGTGGCAC
TGTCGACGGTCTTTCAATGGTTGTGCGTTAAACTCAACGAGTACGAGAACCACCCGACGGCGTCTGCGTACGAGCGGTCGTTTGTGCTCAAACTGGTGCT
CTTTGAAGGCGTAAATCACTTTGCAGCATTGGTGTACTTTGCCTTTTACGTACCGATGAACCCCCCCGACTTCGCATGGCTCGTGTACAAAGTGTATGGC
GCGTATATTGTCGTGTACCACTGTCAGCGCGTACTATCCCGACGTCGGAACAACCAGCACCACCCTCGGAATGAAAGCGGCGACGATACTGACGACGACA
TGGAAGGACAGTTTGCCCTGGCCGAGTATGGTTGGAAGGACAGTATGTTGGACCACTTGAGGCTCGTCGTGCACTTTGCCTTTGTGACCGTGTTTGCCGT
GTTGTGCCCGCTCAACCCGTTTCTATCGCTCGTGCATTACTCGCTCGAGCTGCGATTCAACGGCGCCAAGCTGCTCACGTCGTGCCGCCGTCCTCGTCCG
CGCGGCGCTGAAAACTTGGGCATCTGGTACGTTGTCCTGCACTGGGTGCTCAACGTCGCCGTGGTCACCAACGCGTGGCTGCTCGTGTCCTTGTACCCGA
CCCAACCCCCCACGACCCCGGCGCCGCCTGGACCCGCCTCGCTGGCCGCCATCTCGTCCCAGCACGTGGTGCTGTCGTTGATCCTGTGCCTCGTCGTGTG
TCGCATGCTCGTGATCGTGGGGTACCAAGACACGCCGTCGCGCATTCGGCTGCAACTGGAACGCCAGGCGTACTACGTAGCTAAACTGTACCACAAGGCG
TTTGGATGGCCCGGGCACATGGCCGCCAACACGTCAACCCTGGCGTTCGAGTATTGCCTCGCATTTCCCAACCCCGAAGCCCTCCCCAAGAAGTCCCATT
CTCGTCCGACATCCCCCAAGCCGGCGCTGTCAACGGTGCTGGACGCTCTCAAGAAGGCCAACCTCGCGTTCAATGTGTACCCGTCGGCGGCCAAATCGTC
CACGTACTTGTCGTCGTTCATTTTCTGCGAAGTGCGGGCCACGGAGAGCCAGCTGCAGCAGGAAGCGGTGCGGATGCAGCTGCCCATGCTTCTGGACGAG
ATCATGCTCAAGGAGTTGGCTCACGAAGGGGTGTTCCATGCGCTGCACAAGGGCATGGTGGACGTTGTGGACCGCACGCGGATCGAAGCTACGAGGGTCA
ACTTGTTGCTACTGCTGGAGAATATGCTCACGCAGCGGGTGTTTCACAGCAACGACTACACGAACGTCGAGATGGCGGACAAGCTCGAGAAGTTGCTGGC
CGCGTTGCACAACCGCGAGCCGCGCACGCACGTGTCGTTGGCCCACGTGCTCGCGAATTTCAAAGAGTTGATTGAAGTGGACATTGAAGGCGAACAATTC
CGACAGCTAGATGTGCCGCAAACGCTACTGAACCGCATCGAAACGTACTTGAGCACGGGCGACGCACAGCCGACTACACCCACGTCGGATGTACACCCAA
ACAACGCGTTGAGCTACGCCAACAAGAACTTTGACAAGTTGCTCAGTCAAATGGTGGCCTCGCTCCACGAACGCCCGCTCAATACATTGTACATGGCGCA
AAAGACTTGGAAGTACGGGCTGGAAAAGGTGCTGTGGTGCATCGAAGAGCTACTGAAACACTCGGACGTGTCGGTGTTCGAACTGTCGTCGTCGTCGCCG
TTGAAATGGCTCTCGATGCAGCAA