Description :
From Genome Similarity Track
Location :
scaffold_22:61222- 63130
Sequence
1908 bases(100 bases per row)
TTGATATAAACAATATGGTGCCCAATAGTCCAAACATTCCATGCCAAAGTTTCGAAGTGAAACGGGTATCACGGTGGGACGCGATCTCAACAGGAAGGTC
ATGCAGATGAAATCAACGTCAGCAAATACCTTACCTGTTTTCTCAGCAGAGATCAAATGTGAAACAtgcgcaagatgaaccatcttgctgaattgGTCCA
GTAGCACAAGGATCCCACTTTTGAAATTTGTGTCACGCGGAAGTCCGAATATGACGATCATCACACAGACTTCCAGCTGTCAATTGGCACCGCAAACGGG
CCTGAGTGGACCCGACGGTTTTACTCTCTGTTAGTTGTTATAAGTCTTCCTTACTTGCTCacccacttatacatgtgTGGCCAATATTAAATCCGAGAAA
GCCCGAAAAACATTTTCTCACGTCCGCGATGGCCACCCGAAGGGCTGTCATGGTACTGATATAAGGAACGATGACGCAAATcttcgtgtttaagagcaac
AAACCTTGCTGAATCCTTGTGTTTAACTGCAGAGTACAACAACCCCATTGGATACTCCGGAATGGTGATCACGCGATCGTGTGCAAGACGGAAACCTTGC
AGTGTTTTGCTGGAGTTTCTTTAAAACACCTCAACAAGTGCTGACAAAACTCATCGGACTTGTAACCTTCGACGATTTCATCGCAAATTAAAGTCATTGT
CTGCGCATTGATCGTCCGGACACATTCGAATTGTCGACATGATGGTGCATATTTTTGCTCCCGGACTCTGCATCGTAGTTCGGACGTCTTGAAAACGCAT
CAGCTAACATGTTTGTCTTGTCTGGCTTGTAGTGtacaacaaagttgtacttCGCAAAGAGAGAAACAACCGGCTATCTTCTGCAATAAATGAGGTGTCT
TTACTGCCGTAAGCAGCAAGGCATGATTTTTATGACAgcgcaaagagctcatcTCCAAGCAGGTACGCATGGAAATTAGccaaagcatacttcattgctt
gTAGCTCTTAGTCATGAACAAGAATGTGTTAATTCGCGAGCCGGAGTTGATGCGATTGATACGAAACGACTCAATCTCGACTctcatcatcgtgttgcat
caaaGCACAACCGACGTCATAATCACGTGCATCCCAGACCACGTAAATAGGCATATGTTTGGTATAGGCCAATCACTGATAGCTTTGCCTTCTTCCGGAT
CGACATGAACGCAATTCTTGCCCACAAAGCAGCCGAGAACGGGGATCTCATGCACTCTTTTAGGTTAGTGTAGGGTTGATCCTCTCGCATACCTTGGAAG
ACTTGTCAAAATGATCAAGATAAACATCGACATCAGACTTCTTACCCGTTTTCTTAGTATTAACGAGTAAATTGTCAAAATGACTCGGTGGGAACTCTCT
CAATGGTTGAAACCATTCTGTTGAACGTCGCGGGAGCGTCCTTCAAACCTTGTGGCATGACTAACCATTTCCACAGCAAACCACTGGGGGTACTGACAGC
AATTAGTGGTGTATTATTTTTGCGCTTCGTATCTGATAGAAATCATCTTTTAGATCGATCACACTGAAAACAGTAATTACAAGCATTCAATCAAGAAATA
AATCCTTGTTGTGTCATTCAATTTGTTGAAGGTGTGAACAATGCGCCAACTATCTGTGGCTTCCTTCACTAAAAAGGTGAGACTTGCTCTAACGCACATA
ATTAGCCTTCTATCACAGTGCAAAGAACTCGTTAATTGCAACAACTATTTTTTTGGCAAAGGCCACTGTGTGCGAGACAATACTTCGTACCAGTAAATGT
GTGAACCTCATGACAATTGACTCTGTCAGATGGCAATTCGTCCGGAACCTTGTATGGAAAACTACCAGCATATTCACTAGCAAGTCCATACACGGGGTTT
GTTCTTAG