Description :
From Genome Similarity Track
Location :
Scaffold_275:6122- 8777
Sequence
2655 bases(100 bases per row)
AGGCGAAGAAGACTCCCTGTTGAGGTGGTTCGTCGAGTTGGACGACGCCATAAGAGCTCGTTACATCTTTGATGGGCAAATGCAAGTCGCATTTACTCAG
TCGAACTTGGCCGGACGGGCCAAAACTTGGTCACTTTGTCTCAAGGTGCTCGACCCGTACGTATTGGGTCGTTGGAGGTCTTTAAGACCCGGCTCAGACA
AACGTTTGAATCACCACGAGCTGAGTTCAAAGCTTGATCGGAGCTCCTGAAACTCAAGCAGGGTAAGGGTGATGTGAACGCTTACGCCCAACACATACGA
CTCCTTGCGAGCTGTATAACGGCCAACCCGGTCAATGAACACATGTTGATGACGGCTTTCATGCAGGGCCTTGCAGCTGGTCCCGTCAAAATCCACCTGT
TCCGCTTGGAACTGGATACGCTAGAAGAAGCGATATTGGTTGCGGAACAGGAAGACTTTAGCTTAAGATAGGCTCATGCTACTTTGGGCTCATATCGTCT
CCCAAGACGACAAGAAGTCGGAGGTCCAGAACATATGGACCTCTGTTATGTTGAGCACGAGAGACCTCGCTCTTCAACCAACAAGCGATAGCAGAATTTT
AATCGCTGTCAGAAACTAAGACACTTCGCCTACGAGTGTAGTGCCCTACGCCCAGTGTATCGAAACACTGATCAAACCGATCGACCGTCTGCCAAGAAGG
GCAACGGACGCGGGTCCAACGTTGGTGCAAAATTGCAGCAACGGAGTGGACCGTCAAAAACGTTCAGGGTCAGTAGGGGTGGATCGCCCCACTGATCCAG
CAACCTCAAGAGAATTTGTAAATCTCTTGATGAAATTTGCTTTCGACTCACAATCACTGTGTGTCTCTGCACTTGGTGATAAGGGGTACCTCATCACCTT
GAATTTAGAAGTGACAAAAGATTTGTCACTTTATGCCCGAGTTGACTGTGGGCCGTCGAACAATTTTGTTTATTGCCAGTCTCTAGAGGTTCGTAGGCTC
AAGTTTGTTGAGCGCGACATCCCTCCAACGAGTATAACGGTGCGCCTAGCAACAGGCGCATCGATAACATTGATGAAACGTTTAGTGGGACTTCACTACA
CACTGGAAGATTTGCAGTACGATGATGATTTCATCGTACTGGATTTGGATGACAAGTTTGATGTCATCCTAGGGTTACTTTGGATCAGAAGTCACGAGCC
AAGGGTCATCTGGCAGCATCGAACCGTGAAGATATCTGCCACTTGTTCATCAGATTGTCATCTGATGAACGTCTTGGAGCTTCCACAAGCGTGTGGATGT
ACTGTGAGTGAGTGCGATGGCCTCACTTGTAGTACGGTCATTAGTACGACTGCACAAGATCGCATTGTGACAACCAATCACACTGTGGAGAAGGCTGCCG
GCGGCTGTGCGGATGCACAAGCAGCGCCGAACGTCCACCATTCGAACAAGTCGAGTGGATTAGAAAATGGTTTTAAGCCTAGCGGGCGACATCCAATGAA
GAATGAGCCGGTTGCCCACACAGGGCAACATGATGATCCTAGGTCGACTAGAGAGTCGACCATAGAGGACCTGGCTGTGATATCGCAACCACAGCTAGAA
AATGTCGAATGAATTAGTCCCCACGTACTTGAGGGAGAAATTACTCAAGTAGATATCAGAGAGGTAATGAGACCTCATCAATCTGAGGGAATAAGTCCCC
AGAAACTTGTGAAAATAGGTTCTTAGGAAGAAACCTAGACATTGAATGTCTTGGTTAATGACGGGTCAGGTGTAGGCCCTTATACACTTGATCTGATCGT
GCCTTCCAAAGTTGACTTCAGAGATCACTCAGTTGTCTACGCTAGAACCGAAACGATTCTTCCGAGATCTGCGTAGTTTCAAGGTCAAGCGGATCTGCGT
ACTCGTCGCAGAGGACGAGTACGTGACTGATATTTCGTCAGCAGTAGTATTTGCCAAGAACAAATGGGTTATCAGCAGCTCTTCGATGGACGAATTTGTA
CTTGATGAGACGACTTCGATTGAGCGATACACGTCTCAATCTTGGGAGTCGCTTCAGGCAAATTCTTTGTATAGGATTTTGATCGAATTCAAGGATGTGT
TCCCTAAATCCGTACCATGCGAATTGCCTAAGGATAAAGGCACTCGGCATGAAATCGAGCTCGTACCAGGATTGAAGTACTGTGTCATGAAGCAGTGGTC
ACTGCCTCGTGAACAAGTACTTGCGTTTAACGAGTTGTTTGCCTATCGCTTAGCAGTGGGCCAGTGAGGGAGTCAACCTTCCCACGTAGCTCACCGAACT
TCTGTGTGCGCAAGGCCACAGGAGGATGGCGGATAGTGCACGCATTCAACAAGTTGAATGCTGAAACGGTACCAGCGCAAACGCCGATACCGAGGAAGGA
TGTCGTCACAGATGGTATGGCGAAAAGTACCATCTTTTCGTCTATGAATATGATGGATGTCTTCTATCAGATTCTTATGCGTGAACGAGACATCCCGTTC
ACAGCAGTGAACAACCCCAGCGGTATGCTTTGGAAATGGCTGGTTATTCCACAAGTGCTTAGTAATTCCCCAGCCACATCCAACAGATCCGTCACAAATC
TGTTGAGACAGATGCGAGATTTTGCACCTAGTTACTTTGACGATGTATTTGTCCA