Description :
From Genome Similarity Track
Location :
Scaffold_6:612106- 613578
Sequence
1472 bases(100 bases per row)
CCAAGGTCCTATCAAGAGGCGGTTACGAGTGAGGATCGTGCTCAACGGAAGGCAGCGATTGCAAGTGAGCTCAAGTCGCTGATGACGAACAAGACATGGA
AGTTGGTGCCCAAGCCCAAACACCAGCGCGCGATTGACTGCCGCTGGGTGTTCGCGTTGAAGCGCGATGAGACTGGGAGAGTCGTTCGGTACAAGGCTCG
CCTCGTTGCCAAGGGGTACTCGCAGCGACATGGAATCGACGACGAGGAGACCTACTCACCGGTGGTGTACCTGAACTCCATCCGTGCGAAACTCGCGAAG
TGCTGCGCCGACGGAATGGAGATTGATCAATGTGACATCGACATCGCGTTTTTGTATGGAAAGCTCGAAGAGGAGATCTACATGGTGTTGCCGGAAGGAC
TTCGAGAACTGCTGGATTTGGCTAAAGCTCAAGGTGGAGATGACGTCATATGCCTGCTACTGCAGAGTTTGTATGGACTCAAGCAAGCGTCTCACGTATG
GAACGGGGCGATCGACGCGCATCTCAAGAGCATGGGGTTTCAAGCTGCCGATGCCGACCCGTGTGTCTACACGAGAGGTGCTGGCGACGACGAATGCGTG
GTGTGTCTCTACGTCGATGACATGCTGATTGCATCTCGCCAGCGGGCCATCATTGGCTCGGTGAAGGCAGGTATCGCGGACAAGTTTCACACCAAGGACC
TCGGGCGCGATCGATTCATCCTTGGCATCGAGATCGACTACGATATGGAGGCCAAGACGCTGGGCATCTGCCAGCGGGCGTACACCGCGTCGATCATCAA
GAAGTTCGGCCAGGCGAATGCGAAACCGTGCCTGACTCCACTCGACCCAAGTGTGCAGTTGACCAAGGCGGACGGACCCCAAACCGGGGAGGACAAGGCC
AAGATGAAGTCGAAGCCGTATCGCACTCTCGCGGGAAGTCTGATGTACCTGGCGTGTGGAACTCGACCGGACATTTCAGCTGCAGTGGCCAAGCTGAGTC
GTTTTCTGGAGAACCCCGGTGAGAAGCGCTGGGATGCTGGTATCCGTGTGGTACGGTACCTGTTGAAGAACAAGTATCTCGGAATCGTCTACGATGGATT
GCTTGGCACGGAGCTCGTCGCGTATTCGGACGCCGACTGGGCTGGTAACCGCGACGACAGACGCTCTGTCAGCGGATGATGTGTGGTGCTCCCGTGGTTT
GGCGCTCGACTTTTCAGAAGACGGTCGCGCTGAGTTCGACTGAGGCGGAGTACATGGCTCTCAGCGAATGTGTGAAGGAGGTGGTGTGGATGCGACTTCT
GCTCAAGGTTTTGGGTGCGGAGCAGGATGGATCTACGGTGATCTACGAGGACAACCAAGGTGCCATGGCGTTGGCGAAGAATGTCGGCTACCACTCTCGC
ACCAAGCACATCGACATCAGATACCACTTCATTCGCGAGAAGGTTGCGACTGGTGAAGTTGAACTGGAGTAC