Description :
From Genome Similarity Track
Location :
contig_33:612- 4562
Transcript NameFunction/comments
g7948.t1hypothetical protein

Sequence
3950 bases(100 bases per row)
AGTCGCACTCTGTTGTACGAGATGGGGTGCCGTACGCGTCTAACATGGTCGGTTGGCCGTCACTTTAACGCAGGGACAATATGCGATCAATGGTGGCTGC
GCGGCGGAGCATTCTTGTGAACAGCGGCCTTGACCTGGGAGACATCTTTGTGCAGTACGATTCTCACCGCACTGGGTTCGTGTCTCGATCGATGTTCGCC
ACTCTCTTGCGAGACTACAGCATTTCCATGCCGGAGACCACGCTACACTTCCTGATGATCCAGCTTGCGAAGCCGTCAGACACGACGTCTGTTTCGTACG
TGCGCTTCCTCGAAATCACGGATGTAGGAGTTGCAAGGAGCGCTTCAGCGAACCCACCGCTCAGCCACGGACTGGAGAACTCCCCGGCTCGCTTCAGCAG
TTGGACGAGTGGCCGGTAAGGATTCTATCATTGAGGATGAAAATTAAGACGCTCATCGTTTCATGCTCGTGGGTCTTGCTTTGTGTGTGACAGATCCAAC
CCGTTCGAGCAAGAAAGTGCCGCTCGAGGTTATGCGATGCAAAACGCGGTTCCTGTAGCTACTCAACCCGCCAGAGTTGTGAACCATGCGTCAGCGAGCC
CCGAGTTCGCAACACCTTTGCTCAGACTTGGATGGGTCTGTCGAGTGTGCGCACACCAGCAGATAGTAGATTGGGCCACTCACTGTGAAATTTGTGAAAC
ATCAAAACCGCGGCCAGGGCTACGCGGCGAAGGGTATATCAAATGCTTGCAGTGCAAGTTCGACAATAACTACGACATGGAGGAGTGTGAAATGTGTGGG
CGTCCACTCAATGCAAGTAACAAAAAGATGTCGAAATCAGAGAAGAAGCGCAGATCGAGAAAGCGCTACGTCTCAAGCTCTTCGTCGAGTTCTCCGTCTT
CATCCTCTTCTTCAAGTTCATCGGGCCATCGCCGAAGTAGCAGGCGCAAATTCGAAAAGCAGTCCCGCTCGGCTCGATCAAGTCGAAAGAAAGAAGAGAA
GAAGCCGCGGTTTCAACGAGGCGAGGAAATCCAAGCCATTCCTCTCGGCAGAAGAGGTTATGAGATCGGGGTGATCGCACGCGTCCGGCCCAATGGTACG
TATGACATTGAGTTTGACAGCGGCCTTTACGAGAAGAACGTCGAGGAAGACTGCGTCCTCGAGATTTCACGTGCGCGCGTTATCAAGGCCAAAGACTTAT
CCGACAGCGAGGAAACTAAGCCGAAAGCTAAATGCTCCGATGACGACAATGATCCTGGGTACGAACCAGGAGATCGAGTCGAGGCTCGTTTTCAAGGCAA
TGGACGCTTCTTTGCTGGTACAATCAAGAAATGCAGAACAGGCGGATTGTATGATATCGAGTACGATGACGGTGAAGTTGAGCTTCGCGTTCGTTCGAAG
TACATTAAGCGCGAGGAGGCGAAGAATCAGCGGAAGCCTTCTCCAAAAGAAGATGACGTATCTACCTCTGAAGTGCCGTGGGCTAAAGGACAGAAGGTAG
AAGCCAAACTGCGTGGGTGCACAGACTACGTGAGATGCGTCGTATTTCACGCAAATGCAGATGGCAGTTGTGACGTGGAGCTTGACACTGGTGAGCTGGA
AAAACGAGTTCCGGGAAGAAACATTCGCGCCCGTGTGAGCTCGCCAATAAAAGCGAGGCCTACCGTCCAAAGTGAAGAGGAACCAGTCCGACCAAAGAGA
CCCTTGGTGAAGAGGCCTAGTGCACCTTCCACAAGTGAGGATTCGTGTGCCCAGCCTAAATGGAGGTTCAAGCAAGGCCAAGCTGTCGAAGCAAAGCCTA
AGGGAAGAGATGGATATTTCCCCGGCGTAATTGCTAGATGCCGCTTGAATGGCTCCTATGACATTGATTTTGACGACGGAGAAAAAGTATTAGCAGTATC
AGCCATCACCGTCCGCGCTATCGAAACAGCACCCGCTGCCAAGAAGACAACAACTACGCTTCACAGGAATCACTCAAGGCAACCATTGATTTCAAAGTTG
GCCAACCAATTGAAGCCCAGTACAAGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTACGACATCGACTACGACGAC
GGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGCGGTGGGCAAGAAGGGCGGCGCTGACAGCGACGACGGCCCGAAGCAGAAGAAGTTCAAGGA
GGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTACGACATCGACTACGAC
GACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGGCGGCGCTGACAGCGACGACGGCCCGAAGCAGAAGAAGTTCA
AGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTACGACATCGACTA
CGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGGCGGCGCTGACAGCGACGACGGCCCGAAGCAGAAGAAG
TTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTACGACATCG
ACTACGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGGCGGCGCTGACAGCGACGACGGCCCGAAGCAGAA
GAAGTTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTACGAC
ATCGACTACGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGCGGCGCTGACAGCGACGACGGCCCGAAGCA
GAAGAAGTTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACGTAC
GACATCGACTACGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGCGGCGCTGACAGCGACGACGGCCCGAA
GCAGAAGAAGTTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGGCACG
TACGACATCGACTACGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGGGCGGCGCTGACAGCGACGACGGCC
CGAAGCAGAAGAAGTTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAATGG
CACGTACGACATCGACTACGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGCGGCGCTGACAGCGACGACGG
CCCGAAGCAGAAGAAGTTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCTGAAT
GGCACGTACGACATCGACTACGACGACGGCGAGAAGGAGACGGGTGTGGCGGCCGAGCTGATCCGGGCGGTGGGCAAGAAGAGCGGCGCTGACAGCGACG
ACGGCCCGAAGCAGAAGAAGTTCAAGGAGGGCGACAAGGTGGAGGCCCAGTACAAGGGCAAGAGCAAATTCTACCCGGGCGTGATCTCTCGCTGCCGCCT
GAATGGCACGTACGACATCGACTACGACGACGGCGAGAAGGAGACGGGTG