Description :
From Genome Similarity Track
Location :
Scaffold_3427:612- 1709
Transcript NameFunction/comments
Phypl_g15827pol protein

Sequence
1097 bases(100 bases per row)
CGTCAACTGGATTCACTCCGTTCTACTTGAATGGGATGCGTCATCCCCAGGTGCCGCTCACTTTACGTGGGGCCACCGATGCTTCGGTCGTAAGTGGGGG
AGAGGCTAGGGAAGATCTATCCTCCCCAGTCCCTGAGGTGAGACCAGCCGCACTGCGCAAGCAATTGACGTCGTTTGTCAACGACAGGTTGAATGTCATC
AGCTGGGTTAGAGACGCAATGGCGTCAGCCCAGGACAGGCAAAAGGAGTACTCTGACCGAAGTGGAAGAGGAAACTTAAACGTGTTTAATGTGGAAGACT
TAGTACTCCTAGACACGAGGAACCTACCCATGAACACTGTAAGTGCTGGCGGCAGTaacaagctgaagcacaggTTCATTGGACCCTTCGCGGTCCTGAG
TATGCACGGAGCTGTCTACACCATCGACTTGCCTAAGTCGATGGCGGCCCACCCGACATTTTATGTGAGTCGTCTGAAGCGGTACCACGACCCGCAGGAA
GTGGCGGGTAGCCACCAGgctcggccacctcctcgaAGCGAGACTAAGTCTCAGGCACATGTGGCCCCTGATAAGCGATCGGATAGTCCCACGGACCGTA
AGGCCGTGGCGCATACGCTGGAGCCGCGTGTGCCGAGTCGCCGTGCGAGCCATATTGGTACGGCTGGGAGTACGCGTACGGCTGAGCCTCCCGGTAAGGT
GCTCGGCCACAGACCTGGGGCTGGAAGTCATGTATTTGACGCCGCAGGTCCTCGACCTCAGAGGTCAGAGCACGTCATCGACCCGCTCAAGGCGATCATG
ATTCTCCCGCTCAAGTGTCTGGGTGTGGCGGTGTAAGCCCTCCAGAGCACCGAGTTTGCCGGAGTGGGCAGCAGCCTGGCCAGACCAAGCGCGATCTCGA
GAGCATACACTCGATCGCGGAGGAGACGAATATCCTCTTGTTGCAGCGCAACAACCTGGTCTGTCGGCcccgcagccgcagcccTCGGAGCCTCCCTCCT
CACAGGAGACTAGTACTCATAGTCGAGCGAGGCCTCCACCGACCCTCCTCGACCGTGGTGGTGAGCTGCATTACCACGTGGAGCAGGTGCTCCTGTA