Description :
From Genome Similarity Track
Location :
contig_5:61156- 65781
Transcript NameFunction/comments
g1614.t1hypothetical protein
g1615.t1hypothetical protein

Sequence
4625 bases(100 bases per row)
CGCAGCAAGTTACCGGCCAACCAAACGTCAACTAGCTTGCAGCATGGCTCCGACTGCTGGTATGTCTTGCTGCGTGTGTGTACCTACCCACCTCCGCTGC
AATAACGTCTAACATCCCTACGCTTCCCTCTCGACCGCAGGCACCCGTCTCCGCTTCAAGAACTCGCAGCCCAAGAAAACGCAGCAGACCAAGAAGGTTC
CGTCGCTCAAGAATCGCATCCGAGGACTCGAGCGGTTCCTCAGTCGCGGGGTGCGTTGGCTGCAATTGCGAGTGTGGAGCGTTGCATCATTTGTATTGTT
TCTAATATTTTGCGTTATTGGTGATGGTGGTGCAGGGGCTGGCTGATGCTACGCGGAGAGCCAAAAAGGCGGAGCTCCAGCAGCTCAAGGAAGAGGTTCG
TGCACTTCGCATCATAATATTTGTAGTTATGCAAATAAAACTAAAGTTGTGGTTTGTTGATGGTTGGGTAACAGCACGAGCAGAAGGGAAAGGTCGCAGA
GGAGAAAAAGAATGCCGAGAAGTACAAGAGGGTGAGTGCACGCAGCCAACATTGCTACGTAGCAACACTCGGGGCGTTTTGATGAGGTGATGTCTGACTT
GGAGCTGGTGTTGATTATGTCCTAGCCGCGCTTTTTCGAGCGTGTGAAGGTGATGCGGAAACTGCGTCAGGCTAAAAACCGCCTTGAGCAGGTGAGGAAA
TTTGTTGATCACAGAGTCGCAAATATGGGCTGAGTACGACTCTAATATTTGTTCTGGTCGTAGGCAACGGATAAGGCCGAGCGTAGTGAGCACGAAAAGA
AATTCCAGACGTACCGCGAGGAGATGATGTACATCTACTACTACCCGACGAGCGAGCCTTACATTTCACTGTTCCCGTCGACACCTCACTCGGAGAAGAA
CCAGAAGCGCCAGAAGGAGATTCGTGTTGAGGCGATCGCCCGTTTCGAGGAGGAGCAGCCTACTCAAGAATTCCACCACTTTTGCTTCAAGACGAAAGAT
TCTGCCTCTGCAGGTGAAGCTAGACCGGTTGTGGAGCTTCTGCTGAAGAAGCCCAGTAAGGAAATGGTGAAGAAGCAGAAGAAGGCCCGCAGCAAACGTG
ACAAGTCAGGTGAAAAGCCGAAGCACACTCCAGCTCTAGTTGACCAAGATGACGATGATGAGGTGCCGGATGCATCCAAGTCGGAGAATGAAAAGGAAGA
GGAACTGGAGGAGGAACAGGAAGAGGACGACTTCTTCTTGTAAGTGTCGGTACAGAATATAGTTGCAACGAGTCGGGTCGTTGCTGTTCACATCTGTGCA
GACAACCGTACGTTCAAGGTTTTCGTTCTTGCGATTTATTACTTCAAAGTACTAATAGTCTTTACGCTGACGAGCTCATAAGGAGGAGGAGGAGGAAGAC
AACTTGGACACGAGAAGTCTGTAGAAAAATATGAGGAGGAAGCATCGGACGATCTCGAAATTCAGCTAAATCAGAATAGACGGAGCGCCCGCCGTGCTTG
CGGTTTGCTGCTCTGTGTCAGTGATCATGTCTGCTTCAGCTTGCGATGCAGCCGCCAATGCGTTCATGTTGGTGAAGCTGAAAGACCTGAATGCATCTGA
GAGGTTGGAATCTTCGGGACTACCGTACATTCCACTTGGGAACCGATAGTGACTATTGTTGTCTTCCATCGGCAGTCCGTCGCCCATGTATTCGTCATGA
GTAGCATCCACTGTGTCAAGTGCATTTAGCGCTCCTGCGGTCCCCCACGACATGTCGACATCCGCTGTACCTGCAGAAGTACAGCTTGCGTTGTTGTCAC
CACTGTCACAATCATCTTCTCTTTTCGGGTCAGACGAACTCAGTGGCTGATCGTCATTCTCAGGCCCAGAGTCGATGTTGTTCTGGCTGCTACTGGCGGA
ACGGGAATCGACATCAAATTCGTCGTCGTCGATGAATATATCCGTGAGATTACGGTTGTTGAAATAGCTGGTGTCGTTCGGCCCTTCCAGTGTCGGTACG
AACGGAGGTACAGATTCCAGGATCGTATCCCAATTGATACCATCGAAAAAGGGTGCAGTTTGATCCCCTCCCAACCCATACGGGCTGCCGGGTTCGGGTC
GAGTAGCTTGTCTATCAGGTCCACCGCCTCGAGCGACAAGCACTTCTCTCCATCGGGCCACAGAATTTGCCGCTCGAGAATATTCCCGAAGATCGCTTCC
ACAGTGTCATCATTGAACGGAGGAAAACCAACCAGCATTTCATAAAGGATAATTCCAAGAGCCCAGTAATCCACGGGAGGGCCGTGAGGGACCCTACGAA
TGATTTCAGGCGCCAGGTAGTCCGGAGTACCACACCGTCCATACGTCTGATATGCAGACTTATTTTTCAAACTCCTTTTCGCTGATGAGGTGTGGCGTGG
ACGGCTATGTGCTGGAGCAGACGGCGTGACTCCCAGTGGAGTGTCGGGTAATATATCCGAATCCTGGGCCATGGACTCATCGTCAGGTTCCGAATCCGAG
TCACCAATTGTCACGGCTTCCTCGGACAAACCGAAGTCGGTCAGCTAAAATGTGGGAAGAGAATTCCAGTAGCGATTAGAGGTGAAACGATAGAGACGAG
AAACTGTATACAAGTACTAGTAGCTGCTAACCGCACCTTAATGTGTCCGGTTGACGAGAGCAAAATGTTATCGGGCTTCAGGTCTCTGCATCATCATATG
CCAAAAACCAGGCAAGTGGATAGACAGACACATGAGTGATCGATCTATGATAGCGTGCAATAGCTGCGAATTGAACTGTCCAAACCTGTGGACGCAGCCT
TTAGTGTGCAGGTGATTGAGCGCGATTGCGATCTCCGCAATGTAGACGCATGCCACCTGATCAGGGGTAAATCATAGTTCGTTAGCATCATTGATCGTAC
TTTTTGCAACATGCACACAAGCTCACCTGCTCTTCCAACTGCACAATGCACTCCAACAAGGACATGAAATCTCCACCGGGAAGATATTCCATCACGAGAA
AAAGGTTGCGCCTAGCGATGTCACCAAAAATAATATCAGGTATGAGCTACGCGGGTACTATGAGCTTAGTGCTGCATGTACTGCTTACTTGGTTTGAAAC
GTCCAGAATAATTTCACGACGAATGGACTCACGACGCTGGCGAGTATGTTCCTCTCTGTTTCGATCTGCTGAATCTGTTGGTGGCACACAAAGCGAGCAA
CAGAGCAAAATGCTCAGTAGGCAGCCCTGTGATAGCAACCATCCCAGGCTGCAGGCAATGCGCTGTACCTGCTTTTTGCGCAGCAAGTGCTCTTTTCGCG
AGCACCTTGATCGCATACTGATCACCAGTTGTCTTCTTCCGGGCGAGATATACTTTACCGAAAGCACCTTTCGAAATAGGCTTAACAATCTGGAAATCAC
GGATCGAGACACGATAGGAGGCTGGCTTCAGACTCGCCCGGCGCGGTGCTCGAAAGCCATCGCTGCTTTCGATATTCTCCAGGGACTTGGTGCGTTTTAG
CGGCGTTCGCACTACCTCGACGGGGGCTTGCTGGAACATCACCTTCTGAGATGCTCGCATTTTGCTCATTTGGCGTGGATCAAGTTGCGCAGCTTGGTGC
AGTATTTGATCCCGCGTTCGACGGCAAAGTTGGTGTCTCGATCTCCTGTTGTCGTATTCTATCGATAATTTTCACTAGACGTGCACACAACGCAAACGCG
TCGACACTAGTCACATCACAAGTCGAAGCCTGGATCGCCACTACACGCAGTGCGTGGTAGATGTGCATTTCCTCCTGGTCGAACATGGGTCGCATGGCCT
GCGCGCTCAGCGTGGCGTTAATCGAGGCCGTGAGCTTCACCAGCGAGTTGTTAATCACATCCGCTTCCAGCTCCACCCTCTTGGACAGTACGCAAAAATT
GGTATGTTCGTCCAAGCTGTTGGCGTCCACTTTCGTCTCGCAGAGCTTGCACACGACCACGGACTTGTTGGCGCGGTGGAACGTGACCGTCATGGTCGTT
TACTGAACTGCAGGTTGTCCAGCACGTCTTCGGGGGACGTGGCGGCCATGTCCCGTCCATTGATGGCGTCCACCATGAGTCCCCTCGTGATGGTCACTCC
CGGGGGAATGTGCATGACCACCGTCGTCCACGTCTCGAGGTGGACGCTCTTGATCACGACCTTGTTCTTCTGGGTGTCAAACACAAACTCGAGCCCCAAA
AAGCCGTCCCCGAACGTCACGTCAAAGGTCTCACCCCTCGGACGTCCTCAAACAGGTCTCCTCCGTCCTCGAGCATGGCCACGCCCTGGTCGTCGTCCTG
GTTGCCGTCGCTAGATGCGAAGCGGCGCCACTTGACCTGGTTCTTCTCCCAGCGGTTCAGCACGTCCTCCAGCACGTCCGGAGTGGCGTCCAGCAGCCCA
CTGCGACTCATGGAGGCCCCGCGCCGCTGAAGGGCGGCACGTTGAGCGTGTACTGGCGCTGCAGCCGCTGGGGCTGGATCTCGAGACGTAGCTCCTCATG
GATCCGCTCCATGTCGCTGCTGCTGGTGCTGCTGGCGCTCGGGCGGCGCCCGCTGCTGTCCGTGGGGAGCTGCAGCTCGGCCACGCGGGCCAGGGCGAGC
TGCTGCAGCGCTCGGCCATGAGGAA