Description :
From Genome Similarity Track
Location :
Scaffold_465:6115- 10947
Transcript NameFunction/comments
g12063.t1ETI34642.1 hypothetical protein F443_18889 [Phytophthora parasitica P1569
g12064.t1OWY97538.1 hypothetical protein PHMEG_00031912 [Phytophthora megakarya

Sequence
4832 bases(100 bases per row)
ACAGGAGCGATTATGGCATCATTGCTATCACCACGCTTGATCTGACTCTGATGAAGAACAAGATCAGGCTTACGGCTCAAGATGGGCCCCATGACCCCGC
GTGGACGATCGACTCTGGTTGTACCCGCCACGTCACGTCCAGTTCGCACTGGTTCGAGGACTTGAAACCCATCATTGGTAAAACCATCATTGTTGGTGGA
AACCACTAGATCCCAATTCTGGGCACGGGCACTGTGAACATGACTGTCACCGACACCAAGGGAAGCAAGCGCATCATTTCACTGAGCGACGTGCTCTACG
CGCCCGAACTCAAGTTCAATTGCTCTCGGTGCGCCAAGCTGTTGATGGAGACTACAAGATTAACTTCCCCAACGCCAAGAAATGTGTTCTGTTCTACGCT
CACCATACCAAATTCGAGGCCTAGACTGGAGAAGGAACCAACCTGTACCTGTTCAAGGCCCTCCCAACTGACAGTGACCAAGCGGCCCACGTGGCCAACA
CAGGTATGTCGATAACATCATGCTCTGACACAGACGAATGGGTTATTCTAACTTTCGCATTATGCAGGATCTGGCTAAGACCGACAAAGTTAAGGACATG
GGACTGTCGAGATTCGACTCCAGCAAAGACTACTTCTGCTCATCATGCACATACGCAAAGTCGCACCGTAACCCGTTCAATAAACGATCCGTTGAAAGGG
CGAAATTCCCTCTTGAAAAGGTCCATACCGATATAACTGGACCATTGCTAGTTGCAACGCTCTCGGGCTGCCATTACTTTCTCACTTTCATCGATGACTT
TTCACGCTATATGTTTATCTACATCATCAAGCGGAAGTCAGACCTCTACGAATGCTATTAGAACTTCAGAAGGAAGCTCGTAACGTGTTTCGCGCTGACG
TAGGCCAGATCGAGTACACCGAGAACATGTACGATGAAGAAATCCGTCACCTCCAAAGCGACAGCGCCCGAGAATACGAAAAGCTCGGTCGAATCATCTT
TGAGAAATACAACACACACACACAATTCACGAATGCCTACACCCCTCAGCAAAATGGGGTCGCAGAGCGAAGGATGCGCACACTACTTGAACGAGCACGA
GCCTTCCTAATTGATGGGAACTTACCGCACGTTCTCTGGGGAGAATGCGTGAAACATGTCACTGATCTCCTGAACATCACTCCAAGTTCTGTTACGGACA
ATATCACTCCCCAGGAAAAGTGGTTCAAGCGCAAACCATCCACACACTACATCAAAGGCTTTGGGTGCGCGGCATATGCGCACATTCCAGAACTCTATCG
AACCAAATTCGAAAAACGAGCAAAGAAATGCATATATCTAGGTATTCCGTCGAATAATAAGGGGTACAGTCTTATCGACATGACCGAAAATCGGATAATC
TACAGTAGGGATGTTCAGTTCCGAGAATAGGAATTTCCTAAGATAGAGTTTCTTCAATCTCCAACCACGGGAGACCTACTCAGACCTAGCGCTGAAACTA
CAGCACCCACACGACAACCACTACCATCTATCGTTGAAATGCTCAAACGCAGCGCGACAGCACTTGCAGCTGACGACAGCAAAGGTTCGAACAAAAAGGC
AAAACACGCCCAAGAACACATGGATCTAATACATCCCCTCAATGATCAACTCGATGTGGAGGAACGACGAGCGCTGGAGAGACAAACGCACTCGTTGCTG
GCGATCCGACACATTTCGGAACCAAAGACATACCGAGAAGCAATGCGTCTACCGGAAGCGACGCCGGTTACAACATCCCTAAAACTTGTTATAAATTTGT
TCTAAATGCACTAAAATACAGGTAAGCTTTCACAGTAGGCTATCGGTATTAGAACAGTTTTTTTTAGAAAAACGTAGTAGAGCTCTATTAGTGCAAATTC
CGTCTGACTACCTTTCACTCGAATTCATCGTAGTCGGGAGGGATTACGGGATCGACGCACGCAGCATGTGGAGGAGGCTCACGGCGATGGTTCTTGACAT
CGTCAATGAGGCGAACGAAGCGACGGGCCTCCTCCTTCGTGATTTCCACACACGTCACCAGGCTCGGATGCTTCACGCTGAATTTTTCGCTGAACAATCT
GTTATATGATTCTAACGGGTTGTTTGTGCGGTTGTGCACGTCAATACCTTCCTCGATCATGCTGTTCACGTTCCATAGATCAGCGTCGTAGTTTTTCATC
CACGTCGACCGGAAATAGCGCCAAAAGACGTCCCATTTGGTTTTACTTCCAGTTTCCGTGATTCTGGAGCGTACAAATCTAATTCCCTACAGAGAAACAA
AACTTATTAACCATAAATCTTAATCAAGAAATATCATAAGTTGAAGTGGATACAGTACCTAGTCAGCAATTTCAGCGACGGGAATTATGGTGAGCACGTC
CACCATACCTGAGCTTAGAGCTGCAGCAATCTGGTCCTGGGGGATACGGAGCTCTACCATCTTGCGGCGGAGTGCCTGTTTCCAATGAAACAGGCAACCC
ACGATTTTGACTAGCGGGAATTGCTCGATGACAGCATTCATTAGCCCCCTTTCAAAATCGCACGTCACAGTCGCTGGCTCCAGAAGCCGACCCGTCTGGA
TGATCACAAAATTCAGTGCATTCCAGTAGGCGTCTTGATGCTTGGAGTCCATCAGCACGTACATGGCAGGTACGTAGACATCCACGCCGAGGTCTTTCAC
CATCACGATCAGGCACTGCCTGAACGGCGCCGGCACCATTTTGAACGTGCCATCAATGTAGATGGCAGCATTAGAGTACCGTAGCAGACGGATAAGTTCC
GGGTGCCCAAATCCGACGCCTCTATGCAGGCCGCACCCAATTGTGTGCACCACACTGAACTGCAAGAACGGTCTGGGGTCGTTTTCGGCAACGTTCCGTG
TCGGAGAGCTCTCGATGGCGCGAAACGCATCACTGCCGGTAGCTTGGGTGCGCGCGTACTTGATGATCGCGATGCTGGGAAGCCTGGCGATCGTTTGGAG
CGTGGCATTGGGGTGGGCTTCGTGGAGGGAAGCCATTACCTGCTCCCACACCAAGCTTGGTGGCAGGGAGAGGTTGGCGATGCCAGGCTTCTGCAGCTCA
GAGCGCATCCTGCTGCGTACGTCGGTGAGAGTGGCAGCTTCCTCGTCCTCGTCACAGCTGTGGCTGTTGCGGGCCTTGATAACGCTGTCCCGGAGGATCA
GCCGAGCCCTGCAGCCCGACCGAGCGGGAGCAGATGAAGTAGGTAGTGCCGGTCTCGGCGACTTCGCGCTGACGGTAGAATTGGTAGCCTTTGTACTCCA
TCGCAAGATTCTAAATGCTGCTGCTGGACGTACTGGCGCTTATCAAAATGGGTGGTTTTGAGTGTCTCAAGGAAATTTCTTGAGTTTTGTATAGATAAAT
TACGAAATTTATAGCAATTTTAGATCAAACTCGCCAGATCATTCCCTGATTGGTAATTTATTTTAGAACTTTTAGATCGGTTTAGATCAGTATTATGCAT
GTTTTCTCCTGACCCCCGGAAGTACTCCAGTGGAAAAGTGCCGCACGCTCCGAGTATAAGTCACTGATGGAAAACAAAACGTAGCTACTCACAAAATTAC
CCAAAGGAAGACGAGCCTTACAGTGCCGATGGGTGTTTGTTGTCAATTACAAAGGCGATGGCACGATCGATCGCTACAAAGCACGACTGGTGATTAAAGG
ATTCCTTCTGAAATACGGCATTGATTATGACGAAATTTTTTCTCCCGTTATCCGCATGGAAGTCCTCCGGCTACTACTCACCATAGCAGTTCTTCTTGAA
CTAGAGATCCATCAAATGGATGTCGAAACGGCTTTCCTTAATGGATTCCTCGACAAAGAGATTTACATGGAGCAACCCGAAGATTTTGCCACTCGAGGGA
AAGAAAATGTGGTATGTAAACTACTGAAGAGTCTTTACGGTCTCAAACAAGCACATCGGATCTGGTACCTTACACTATGTACTTTTCCGGTAACCATGAA
ATCCCGCAAACTCTCCAAAGACCAATGCGTTTTCGTTGGAGAAGTCGATTGACATACGTGCTACATCCTAGTCTACGTTGATGACCTTCTTATCATTGCG
CCTACGGTTGCTATCGTTACCTCCATTAAGGACGCGCTCAAAACACGCTTCAAAATGTCTGACCTTGGCGAAGCTCAGTATCTCCTCGGTTGGTCGATCA
TCCGAAACCGGAAAAACAGATCCATCTTTATCCACCAGGAGAAGTACGCTGAACCGCTTCTCTCATCTGAGCTCCTACACCAACCGATTTGAGTACCAAA
CTCTCACTTAACATGTGCCCTGTAGCGCAGGCAGAGAAGGATGAGATGTCTGCGATCCCGTACAGAGAGGCAGTCGGTAGCTTCATGTATTTGATGATGG
GAACTAGACCAGACCTAGCTTCCTTCCTTTCGACAGTCAGTCAATTCCTCGCAAATCCAGGTAAAACACATTGGAATGCGGTCAAGAGAGGCCTAAAATA
TCTCAATGGCACCCGCAACTTCGGTATTATATCCAAAATGTTGATCTTTATAAAACGCAGCACTACCTCTCAGCCTTTTCAGATGCGGACTACGCCAACT
GCCCCGATACACGTCGATCGGTAGGCGGATACATCACATACATGTGTGGAAGCCCTATATCGTGGCAATCCAGAAAACATCACACAGTCGTGCTCTCCAC
AACGGAGGCAGAATACATCGCTTTATGCCACTGCATACAGGAAGTGATCTTCCTCAATCTCTTGCTTACAGAAATAAACCACACCAGTCCTCATGCAATC
ATCAAATATGAGGACAACCAAAGCTGCATCAA