Description :
From Genome Similarity Track
Location :
scaffold_5:61143- 65774
Transcript NameFunction/comments
g8103.t1hypothetical protein
g8104.t1 protein kinase, putative

Sequence
4631 bases(100 bases per row)
CGCAGCAAGTTACCGGCCAACCAAACGTCAACTAGCTTGCAGCATGGCTCCGACTGCTGGTATGTCTTGCTGCGTGTGTGTACCTACCCACCTCCGCTGC
AATAACGTCTAACATCCCTACGCTTCCCTCTCGACCGCAGGCACCCGTCTCCGCTTCAAGAACTCGCAGCCCAAGAAAACGCAGCAGACCAAGAAGGTTC
CGTCGCTCAAGAATCGCATCCGAGGACTCGAGCGGTTCCTCAGTCGCGGGGTGCGTTGGCTGCAATTGCGAGTGTGGAGCGTTGCATCATTTGTATTGTT
TCTAATATTTTGCGTTATTGGTGATGGTGGTGCAGGGGCTGGCTGATGCTACGCGGAGAGCCAAAAAGGCGGAGCTCCAGCAGCTCAAGGAAGAGGTTCG
TGCACTTCGCATCATAATATTTGTAGTTATGCAAATAAAACTAAAGTTGTGGTTTGTTGATGGTTGGGTAACAGCACGAGCAGAAGGGAAAGGTCGCAGA
GGAGAAAAAGAATGCCGAGAAGTACAAGAGGGTGAGTGCACGCAGCCAACATTGCTACGTAGCAACACTCGGGGCGTTTTGATGAGGTGATGTCTGACTT
GGAGCTGGTGTTGATTATGTCCTAGCCGCGCTTTTTCGAGCGTGTGAAGGTGATGCGGAAACTGCGTCAGGCTAAAAACCGCCTTGAGCAGGTGAGGAAA
TTTGTTGATCACAGAGTCGCAAATATGGGCTGAGTACGACTCTAATATTTGTTCTGGTCGTAGGCAACGGATAAGGCCGAGCGTAGTGAGCACGAAAAGA
AATTCCAGACGTACCGCGAGGAGATGATGTACATCTACTACTACCCGACGAGCGAGCCTTACATTTCACTGTTCCCGTCGACACCTCACTCGGAGAAGAA
CCAGAAGCGCCAGAAGGAGATTCGTGTTGAGGCGATCGCCCGTTTCGAGGAGGAGCAGCCTACTCAAGAATTCCACCACTTTTGCTTCAAGACGAAAGAT
TCTGCCTCTGCAGGTGAAGCTAGACCGGTTGTGGAGCTTCTGCTGAAGAAGCCCAGTAAGGAAATGGTGAAGAAGCAGAAGAAGGCCCGCAGCAAACGTG
ACAAGTCAGGTGAAAAGCCGAAGCACACTCCAGCTCTAGTTGACCAAGATGACGATGATGAGGTGCCGGATGCATCCAAGTCGGAGAATGAAAAGGAAGA
GGAACTGGAGGAGGAACAGGAAGAGGACGACTTCTTCTTGTAAGTGTCGGTACAGAATATAGTTGCAACGAGTCGGGTCGTTGCTGTTCACATCTGTGCA
GACAACCGTACGTTCAAGGTTTTCGTTCTTGCGATTTATTACTTCAAAGTACTAATAGTCTTTACGCTGACGAGCTCATAAGGAGGAGGAGGAGGAAGAC
AACTTGGACACGAGAAGTCTGTAGAAAAATATGAGGAGGAAGCATCGGACGATCTCGAAATTCAGCTAAATCAGAATAGACGGAGCGCCCGCCGTGCTTG
CGGTTTGCTGCTCTGTGTCAGTGATCATGTCTGCTTCAGCTTGCGATGCAGCCGCCAATGCGTTCATGTTGGTGAAGCTGAAAGACCTGAATGCATCTGA
GAGGTTGGAATCTTCGGGACTACCGTACATTCCACTTGGGAACCGATAGTGACTATTGTTGTCTTCCATCGGCAGTCCGTCGCCCATGTATTCGTCATGA
GTAGCATCCACTGTGTCAAGTGCATTTAGCGCTCCTGCGGTCCCCCACGACATGTCGACATCCGCTGTACCTGCAGAAGTACAGCTTGCGTTGTTGTCAC
CACTGTCACAATCATCTTCTCTTTTCGGGTCAGACGAACTCAGTGGCTGATCGTCATTCTCAGGCCCAGAGTCGATGTTGTTCTGGCTGCTACTGGCGGA
ACGGGAATCGACATCAAATTCGTCGTCGTCGATGAATATATCCGTGAGATTACGGTTGTTGAAATAGCTGGTGTCGTTCGGCCCTTCCAGTGTCGGTACG
AACGGAGGTACAGATTCCAGGATCGTATCCCAATTGATACCATCGAAAAATGGGTGCAGTTTGATCCCCTCCCAACCCATACGGGCTGCCGGGTTCGGGT
CGAGTAGCTTGTCTATCAGGTCCACCGCCTCGAGCGACAAGCACTTCTCTCCATCGGGCCACAGAATTTGCCGCTCGAAAATATTCCCGAAGATCGCTTC
CACAGTGTCATCATTGAACGGAGGAAAACCAACCAGCATTTCATAAAGGATAATTCCAAGAGCCCAGTAATCCACGGGAGGGCCGTGAGGGACCCTACGA
ATGATTTCAGGCGCCAGGTAGTCCGGAGTACCACACCGTCCATACGTCTGATATGCAGACTTATTTTTCAAACTCCTTTTCGCTGATGAGGCGTGGCGTG
GACGGCTATGTGCTGGAGCAGACGGCGTGACTCCCAGTGGAGTGTCGGGTAATATATCCGAATCCTGGGCCATGGACTCATCGTCAGGTTCCGAATCCGA
GTCACCAATTGTCACGGCTTCCTCGGACAAACCGAAGTCGGTCAGCTAAAATGTGGGAAGAGAATTCCAGTAGCGATTAGAGGTGAAACGATAGAGACGA
GAAACTGTATACAAGTACTAGTAGCTGCTAACCGCACCTTAATGTGTCCGGTTGACGAGAGCAAAATGTTATCGGGCTTCAGGTCTCTGCATCATCATAT
GCCAAAAACCAGGCAAGTGGATAGACAGACACATGAGTGATCGATCTATGATAGCGTGCAATAGCTGCGAATTGAACTGTCCAAACCTGTGGACGCAGCC
TTTAGTGTGCAGGTGATTGAGCGCGATTGCGATCTCCGCAATGTAGACGCATGCCACCTGATCAGGGGTAAATCATAGTTCGTTAGCATCATTGATCGTA
CTTTTTGCAACATGCACACAAGCTCACCTGCTCTTCCAACTGCACAATGCACTCCAACAAGGACATGAAATCTCCACCGGGAAGATATTCCATCACGAGA
AAAAGGTTGCGCCTAGCGATGTCACCAAAAATAATATCAGGTATGAGCTACGCGGGTACTATGAGCTTAGTGCTGCATGTACTGCTTACTTGGTTTGAAA
CGTCCAGAATAATTTCACGACGAATGGACTCACGACGCTGGCGAGTATGTTCCTCTCTGTTTCGATCTGCTGAATCTGTTGGTGGCACACAAAGCGAGCA
ACAGAGCAAAATGCTCAGTAGGCAGCCCTGTGATAGCAACCATCCCAGGCTGCAGGCAATGCGCTGTACCTGCTTTTTGCGCAGCAAGTGCTCTTTCGCG
AGCACCTTGATCGCATACTGATCACCAGTTGTCTTCTTCCGGGCGAGATATACTTTACCGAAAGCACCTTTCGAAATAGGCTTAACAATCTGGAAATCAC
GGATCGAGACACGATAGGAGGCTGGCTTCAGACTCGCCCGGCGCGGTGCTCGAAAGCCATCGCTGCTTTCGATATTCTCCAGGGACTTGGTGCGTTTTAG
CGGCGTTCGCACTACCTCGACGGGGGCTTGCTGGAACATCACCTTCTGAGATGCTCGCATTTTGCTCATTTTGGCGTGGATCAAGTTGCGCAGCTTGGTG
CAGTATTTGATCCCGCGTTCGACGGCAAAGTTGGGTGTCTCGATCTCCTGTTGTCGTATTCTATCGATAATTTTCACTAGACGTGCACACAACGCAAACG
CGTCGACACTAGTCACATCACAAGTCGAAGCCTGGATCGCCACTACACGCAGTGCGTGGTAGATGTGCATTTCCTCCTGGTCGAACATGGGTCGCATGGC
CTGCGCGCTCAGCGTGGCGTTAATCGAGGCCGTGAGCTTCACCAGCGAGTTGTTAATCACATCCGCTTCCAGCTCCACCCTCTTGGACAGTACGCAAAAA
TTGGTATGTTCGTCCAAGCTGTTGGCGTCCACTTTCGTCTCGCAGAGCTTGCACACGACCACGGACTTGTTGGCGCGGTGGAACGTGACCGTCATGGGTC
GTTTACTGAACTGCAGGTTGTCCAGCACGTCTTCGGGGGACGTGGCGGCCATGTCCCGTCCATTGATGGCGTCCACCATGAGTCCCCTCGTGATGGTCAC
TCCCGGGGGAATGTGCATGACCACCGTCGTCCACGTCTCGAGGTGGACGCTCTTGATCACGACCTTGTTCTTCTGGGTGTCAAACACAAACTCGAGCCCC
AAAAAGCCGTCCCCGAACGTCACGTCAAAGGTCTCACCCCTCGGGACGTCCTCAAACAGGTCTCCTCCGTCCTCGAGCATGGCCACGCCCTGGTCGTCGT
CCTGGTTGCCGTCGCTAGATGCGAAGCGGCGCCACTTGACCTGGTTCTTCTCCCAGCGGTTCAGCACGTCCTCCAGCACGTCCGGAGTGGCGTCCAGCAG
CCCACTGCGACTCATGGAGGCCCCGCCGCCGCTGAAGGGCGGCACGTTGAGCGTGTACTGGCGCTGCAGCCGCTGGGGCTGGATCTCGAGACGTAGCTCC
TCATGGATCCGCTCCATGTCGCTGCTGCTGGTGCTGCTGGCGCTCGGGCGGCGCCCGCTGCTGTCCGTGGGGAGCTGCAGCTCGGCCACGCGGGCCAGGG
CGAGCTGCTGCAGCCGCTCGGCCATGAGGAA