Description :
From Genome Similarity Track
Location :
Scaffold_142:61142- 65176
Sequence
4034 bases(100 bases per row)
GGAACGTTGATTTGGCGCGGCTACCCCGGGGGGATACCGGACAGAGATTTGGGGTGGCCGAGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTTAAGTACAAGAAAGTGTGCTCAGGAGCTATTGGGTATTTTAATCGAGCCTTTCCTGGATCAGCGTTAGAACCAGGTCATTGCCTGTCAAAGA
AAGATTGATTGGAAAGTCACATACCATTTATACGACAGATGCCGATTGTTGGGCGATAGTGGTCGTATATAGGTGGGTGGGCGCAATATTTGTCGTACAA
ACCATATCGTGGTGTAGTTTGGGTGTGGTGTATGGGGTGTATATAGTAAAAAGTGGGGTGTATTTAACAATACCCTATTTAATTACTTTTCAGTATTTTG
GAATATTTGTTCGTATTTCCTTGAAGAAAACATTGAACTATTTGTTGTGCAGCCGTACGGCCACGCAGTAACATCACACGGTCGCTTTTCGCAAGCAACT
TAAGTACGGACTTTATAGGATAGTACATCCACGACATAGCAAGCGGATCGATGCAATGGTAGATAATCTGACTACACTTTCGCATGGAACTGGTCTTGCT
TAAAAACAAATGCTAGTATAATGTTTGATTTATGTGCAGTGTTGTAGGCCTCCCTATATCATCTTCGAGGCGGAGACGTAACTTACCAGGTATATATAGC
AGATTTGGCGCACGAACATCACACTCATCAATCACGAGCTATTTCTCCGTCTTACATCACAAATTTAGACGAAGTCATCACGACAATGTCCCGGAGTTTT
TGTTGTAATAAGTATAGTTCATATTTGTTTTTATTTATAAATATTAGAGTGAGACAGGTAGAACTATTATATTTTTAGACGACAGGATCACCGAATGTTT
AACGTGATCAAATTGACTTACGTAAGGCTTTCAACTTCTTTCTGATCCGTGCTTGTACCTTCAGGACGTAACTTTCAGAAGTGGAAGTAAAGCAATTCCT
TGCTGCAGAATTTCGTGAGCTCGTCGTCATAATGCACGTCCACGTCTGTACGATTACCGTTCAGTATAGGTATACGATGCAACATAGGGAATCTAGCGCA
AGTTTTATAAGATCAGACGCGGCTTTGCCGAGTTCTGGCTGTCAAAATCTATCACTTGTAACGTATATTAGCTTGACAGCCGGCCTTCGTTATATACTCT
TTGGCATCGATTGCCTACGAGGCAACCGTTGTAAACAACAATGTGGACGTCAGGGTTTTGATCGCTCATGAGACTAACACAGCGGCAGCTTACGACGCAT
TCCTGGTATCATTGTAATTGTCAAACTCACGTCAGTGTGGCATCGGGGACCGTTTTTACATAGGCTAATGTCAGTTTACTCATACTGTCGAGGAGTAAGG
CAGCGGGAAATGTTTTCATTGAGCTGAAGTTATTGCGGCGTTTGACTTTCCCTAAATGAGCTCATCGCCGGCCAACTGCGCTATCTGTGGGAGTTCAGAT
TTGCCGTGACTGGCAACGTTATGCCATAAAGTGGGTAACTCTAAATACACCAACATTTATTGCTAAATACGCCTACATGATTTATTTAACTTAAATAGAG
CATAGTAATTAATGCTAAGAGAACATACACTATTGAACAAGAGAACGTCCACTATTTAGCCACGGACAGGTCTTCCTTTTAATCTTCACAACTTGAACGT
CTACATAACGATGAGCCATCACATATACACATCTGGTGGTGCAGCTCACGAGGTTATACCTTCAGTTGCTCCTGTCTTGATCTCCACCGCTAGTCGTGAT
GCTGTCATTAATGACGCTGGAAATACTGATGAAGACACTACTGCTACTGCTGAACCTTTAATTTCCCCTCCATTATGGAGTTGTGAAGATCCCCTCCCAG
TCGGACCATTCCGAAGTCAAGAGCAAGCTGTCCTGACCGTCAAGCGGCTCGCCGTGAGCCAAGGTTTTGCTGTCAGCATTTCCAGCATGCGCGGCATCAG
GCGCGTTCACCTCAGTTGCTCGCAAGGAAAAGAGTATCGTGGATTTCATAAACGGCTGATACCCTTGCGAGACCGTGGAACGAAAAAGGTTGGCTGTTCG
TATGAACTCGCTATCACCTTTGACAAGAGGCTACCCGAAATAGAGCATGGTCGACGACATGTTTGAATAACTGTCACACTGGCCATTCCCAATGTATTAC
CAAGACAATGCTGTCGGCACTACCAGCGGCGAGGCGCGTGTCAAGAGAAGAAGACAATATGGAGGCCATGGTCGTCCAGATGCATCAGTCTGGAGCTGCT
CCACGGGTATGTGTGCTTGTGTGGTAATCTAAACATTCAGTTAAACGTGTGTTGTATCTATTTGTGATTTTGTATAGGTTATACTGAACCACTTGAAGGA
GACAAGTGTTATTCTAAAAGCAAGTGATATTCACAACATCGTCCAGAAAGCGAATTTACAGGCTTTGTGTGGTAAAACGCATACGGAGGCTTTTATGCTC
GACTTAAAGGATAAACATGTCACGGCTACAGTCGCAGTGGACCAAGACAACCATGTCCGGTATCTCTTTTGGCAACCTGACCTGTCCAAGGACTTTACCT
GCCGTTATCACGACGTCCTCGTGATTGATTGCACGTACAAGACAAACGCCTATAACTTCCCCCTCCTGCACATTGTAGGCTTTACATGTACTAACCAAAC
TTTCTCAGCTGCATTTGGATTTATGGATGGTGAAGCTTTTAATGACTATGTCTGGATGATAAGCGAGGTTGACGGGATTCTCCCGCGACACCCGAAGGTT
CTTGTTGTAGACTGCGATCGCGGACTTATCAAGGCTATTTCGAAAAAATGGCCAGGCGCAGCAATCATCATTTGCCGATTTCACATTGCAAATAACATAA
TTACCCACTGCCGAAGGAATTTTACAAACTCCAGTGAGAAAACTTGGAAATTGTTCATGGATCACTGGAAGAATATTGTCCATGCGCCTACGGAATCTGA
GTTATGAAGCTCTGGAAGCAGCTCTCTACAATTGCGGTATGTTTTATTTTCAGCACTCGCATTGCAATTAATGTAACAATTATTTATTACTTTATCAGGA
TTACAAAACTATCGAGTATCTTAATACGAACAAGTTTCCCCTTCGCAGTCATTGGGCTTCGTACTGCATCGATCAGTATCAGCACTTCGTACATACTGTG
ACCTCGCGTGCTGAAGGGGCACATGACAAAAACGTAAAGAGATGGCTTAATAGCGCAAGCGGTACCCTCTTGGACGTGTAAGAACGAATTTCGCGAGGCG
TGGAATATAATCACAGAAAGATCAGCGAAACTATGGCAAAGGAAAGAATCGAAATGCTCACGAACCTTCCGGATGAATTTTTACAAGGTTACATCGCAAG
ATCTCACGCCACGCTCTTGTGCTACTGAAGAATCAGTACCTTCTCGCCCTCGACCGTACAAACCTCAGAGAATGCACTGGATATTACATGAGGGTCCTTG
GAATTCCCTGTGCACACATCATTTGCTGTCACATTGACACAAAAAAGCACATTGAAGTTAAATCATTTGCCAAGCAATGAGAATTGGACACCGTTAACAA
CCTCGATCATGAAGTTTTCGGAATTTTGCCACCCTTTCGCCTTCAAAAGACGCAAGGTCGCAATCGGGCGCACCAAAAAACGACCAAGCGTCTACTTTCG
GGCTTCGAACACGTGGAGAGGCAACTTGGTGTCAGGAAGTGTAGCCACTGCCATGAATCCGGCCACGACAGACGCTGGTGTCCCTCGCGTGACTTCATCG
AGCCTGCCGTCGACATTGAAGCGCCCGTCGAAGT