Description :
From Genome Similarity Track
Location :
Scaffold_62:61130- 63802
Sequence
2672 bases(100 bases per row)
GCCGGGATAATACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATC
TACACAGACCACGCGTCCTTAAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGTTGTCCTCCTTCGCGGGATACAACTTCCGCG
TCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTTTTGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATA
CGATCGGATACGCATGGCGTATCGGAACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTCTGGCAGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCG
CGACAGCGCTCACGGCTCCTCCGATATGAGTTGAAGGAGGGCCTCCTCTATTACCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACG
AGGATCTGAAGTTCGGCATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGACCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTG
GTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTTAAGACATGCGAAACATGTCAGCGCGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGC
CTGCCCGTACCGGCTGACTGATGGTAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGT
GTCGGCCGAGCAAGATGGTACATCTTGCTCCGGTTCCTGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGG
TCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCGGATGGTCCGC
AGCGGACCATCCGCAGACAGTCGGCCAGACATAGCACGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCGTCACCACGTACGTGGTCG
ACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGCTCACGCCGTTCTACTTGAACGGCTTCTGTCACCCCAGAGGGC
CTCTCACTCTTCGAGGAGACACTGACGCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCACT
GCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAGCGTTGTCAACAGGGTCCGCGATGCAATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTTA
GACAAACATGGAAGAGGAAACTTAAGTATATTTAAGGTGGGGGACTTAGTGTTGCTAGACACGAGGAATCTACCTCTTGACACTGTCAGCTCTGTCGGCA
GCAACAAGCTGAAGCACCGCTTCGTCGGACCATTTGCAGTCCTGGCCCAACATGGTGCGTCGTAGACCATCGACCTGCCAAAGTCAATGACGACGCACCC
GACGTTCTATGTTGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCAC
AGACGTCGACGATGGCGTCGGAACAGGCACCCAAGCCTCGGTCGGAGCGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCGTACGAACGGACC
CCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAGCAGAGCCT
CGACCCGTCAGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGACCCGGCGATCCACCCGCAGGTGCAGGCTCGCGATCTCTCGCTCCAACAGGTC
CAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCACCGCCAGTCCCAAGGCCAACTGCAATCTCAAGCACGAGGACA
CGTTGACGGAGGCGGTCAACCTTAGGGTCCTGTGTCGGACCCGCGGTCGGAGCACTCGGACGAGAGTGGCTTTCGGGAGGCGCCGAGTACTCGTACTCGT
ACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAGGTCCACTTCCACGTGGAGCGGATCCTTCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCC
TCGTGAAGTGGAGGGGTTATGCCCACTCTGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAA
GCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCAAACGGGGTACGGACGATGAATACATTCCGTGCCCGCGCTCATCGTGAGCGCTAGAAGCCG
CGCGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGCTGATCAAGTGGGCAAATCTCACACGAAGATCATCACGCTGATCCAGGATGCGGGACAGCAGCTG
ATCTTCATGGAGTTCCCGTAAATCCGTGGGTGAGTACTTAAGAGACTCCACCCATGCCCAGAACATGTCCTC