Description :
From Genome Similarity Track
Location :
Scaffold_222:61123- 62618
Sequence
1495 bases(100 bases per row)
TTTAGTTACTGCTCGGTCATTTTTACGAATTAGAGGGTGCTATTTAGATATGTGGCGTATTTTATAGATAGAAATACCGTATGTGTTAAGGATTTCACAA
AGCGTTAGGGGCCTCACATACAAATTATTGGGTTTGCCACTGCGACATATAAAATTGTACCAAATAGCATACAAAAGTTAAGTATAAAATGAACAATTAA
AGACTCGCTGTATTCAATAGTAGGTTTTATTGCCTTTCGTCTTGATGACATCAATGCATTGTCGCGGCATAGAGAAAACGATCGACACAAGGGTAGCATT
CGGAATTGCATTTCGTGTTGCAGTTAGCTCAGACACGCGCTCGAACTGTGTTCAATTGTAGTACACTTGCCTGCTAACGATAGACCATAAATTCTCGATG
GGGTTAAGATCAGGTGGATTTGATAGTCAGTCGAGCACCTGGATCCCCTCTTCACTGAAGAACTCGCGGGTACGATGTGAAACATGTATGCTTGCGCTGT
CAGGTTGTAAAACAAAATCTGTTCCATAATTCAGATGCGCAAACGGTAGAAGATATTCAGGCACTGTATAAACGTAATCATCCAAATTATGCCTCCCTGT
CAGCACAACAAGGGAAGACTTGCTAAAAGCGGCCCATAACATGATGGACCCACTTCCAGCTTGACGTCGCTTCATCTGGCGGACGGACTAGCGCAGATCT
TTCCAGTAGTGCTGAAAGCCGTCGGGCCCGTCAAGATTTCATTTTTTCGTCCGAGAAAATAATGGAGCCCCAAACGGACCCGGCATCTTCATGCAGCAGC
ATGTCCCAGGATTGCGCGCACCATGTCCGCCACCGTGGGCGGCAACGTGTTTTCCATCTTGGCGTACACAAGCCAATCGACGTCGGCCAAAATGCGCTTC
ACGGTGCGGACGAGCACCAGCAGACTTAGCTCGACCTTGAGCTGGGCGGCGGACAAGTTTCCCTTTGCAGAGGTGCGCAAGAGAAGTCGAACGTGGCGCT
TCGAGAAGCGGAGCGGGTCCTCGGCATTTCATATGCAGGAAAGAGGTAGGGGTACTACTCGACGTATAGTGTCAAGGCTCCTCGAGGTAACAGACGTGAT
GGCACGCAAACTCAGGTCAGCCTCTCGAAGCCCCACTATCCTTCCCGCTCGTGATCGGTATGTCTTGGCTTCTTGTTGCCATTCCCGTCGATATACGCCG
CTAACATCTTGCCACCAAATGGCATATGCCGCTAATTTCAACCCAATGATACAATCATGATAATACGTCATACTTAATTTTTGTATGCTATTTAGTACGA
TTTTATATGTCGCAATGGCAAACCCAATAATTTGTATGTGAGGCCCCTAACGCTTTGTGAAATCCTTAACACATACGGTATTTCTATCCATAAAAATACG
CCACATATCTAAATAGCACCCTCTAATTCGTAAAAGTGACTGAGCAGTGGATAAAGTATAGGTGTACGATATTACCTGGAGCGGAGCGTATATAG