Description :
From Genome Similarity Track
Location :
Scaffold_88:6112- 9207
Sequence
3095 bases(100 bases per row)
TCGCCCGAGGAAGAGACCTCGTGCTGCTGGTACGGGCGGAGACGACCGCCAATAAACGTAGGATGAGTACGCATCGTGCGAGGCAACTCGATCGTGTACG
CATTGCCTTTGCGATGTAGTACACGGAACGGGCCGATGTCATTGGGCAGTAGTTTACTACTATTCACGTTAGTTACCACATGCTTAGGTAGATTTACCGT
AGAAAGTAGAACTAAGTCTCCAACATTAAATAGAAGAACGTTTGCTCTTCCATGTTTGTCAGCATTCTGTTTCTGCCGGTACAACGCGTGAGCGATGGAG
TCTTGTACAAAACGGACCATTGCTTTTCGTGCCAGCAGGAAATCTTCTTCTGTATCACTTTGGTTTGTTGCAGTGCGCCTTGTGCGCACCGGTAAGAGGT
CATCTTCTTTTTCAGTGAGGATGTTCTCATCCTCGCTGGTGTAATCATTGGCGATGCTGGATATACCAGCATCGTAATCCTCATATGGGTCAGCAATAGT
GTCATCACAGTTGATTAAGTTACCTTCTTCGATATCGATTTGATCGACATCGGCAACGTTCGCGTCGTCGATTACATCGACACGTGATGAGCAAGAGCCA
GAACGGTTTTTGCTCGAGCGAAAGCCTCCCCCCTTGAATTAATGTCACACTCGAAAAGGGTGGGTAGGCGTGGATGGCGTAAGCCATTCACGAAAAGAGG
TGTATGCCTTGTCGATGCATGCACGGAATTGTTGATTGCAAACTCCACCATCGGTAAGAATTCGCTCCAATCTGTGAAAGATTGGACGTATCCTCAAAGT
TTCTCTTCGAGGACGCGGTTGGCGCGTTCTGTCTAACCATCAGCCTCGGGATGGTCAGAAGTAGACATAGCCACACTTGTTCCGTGGGATCGGAACACGG
ATTGCTTAATCGTCGCCGTGAAACGAGGATCTCTATCGGAGATTAGTTCACGGCGTAGATTGTGAAGTCGTAATACCGTGTCAAATGACGGCACAGGTAC
AACCATATGCTGAGATTTACTCATTAACTGCAGCAAGATATATCATCTTGCTTAATCGGTCTACGAACACAAGAATACCATTATTCTTGTGAGCGTCTTC
GGGGAAATCGAAGACGAAGTCCATTGAAACGTACTGCCAGCACTCTTCCGGGATCGGTGGAGGCTGTAGTGGGGCACGGTATGAAGTACTGGGCTTCACA
CGTTGACGAACCTCCCAAGCACGAATGTACTTGCGTACAAACTGATACTGGCGGGGACAGTAAAAGTCACGACTTACCGTAAGGTAAGTCTTCTCCCTAC
CACGATGGCCACTAGTTGATGCATCGTGGCACTCGTACATGATGCGTAAGAGCAAATCATTTATGAGTGGAGACGACGACACGAGGTGTGTCGCCGGTAA
CGGCTGTATAATACAGCACTCGTTGCGTGTTGTGTATCGATCCGCGGACGATCGATACAAGGCCGGTAAATCTTTGAGAGATTTACAATATGTAGTCACC
AGATGATCCATCAAGCACAGAAGATCCTTATCTTCTGCGTAGGCCTTTCTTACGTCGTCAAGTAACGTTGACGACGGGACACTGACTGTAAGTATCTCAA
CAGTGGTATCAACCTCACTGTTGGATTGCGCGCCCGGCTCGAAATCGGGTCGGCGCGAAAGCGCATCAGCGACGACATTCAGTCGTCCTGGTTTATACTC
GACGGAGAAGTTGTACTCCGCGAAGAAAGACAGCCACCTCCCCATTCTTTGCGAGAGGTGTGGACTGTCTACGGCCGTGCGTAGTGACGCATGGTCTGTA
AAGACAACGAACGGTCTATCTCCAGGAGATATACACGAAACTTAGCCAGTGCGTATTTCATGGTAAGGAGTTTCTTGTCATGCACTGAATAATTACGCTC
ATCCGCTTGTAGCTGAAGCGATTGGTAGCATATGACGCGCTCTGCGCCATCTGTATCAAATTGCATCAACGCACAGCCGATCGCAAAATCGCTGGCGTCA
CAGACCACGTGAAATGGTCTGTCCTGATATGCAATCTCCAGAATGGGAGTTTGCATTAAGCCCTGCTTGATACCCTCAAAGGAACCCTGAAAGTCGGCGT
TCCATGACCACTTCACATTTTTCTTGAGTAAACAAGAAAGATGCACAGTCATTTCGGCGTAATTGCGCGAGTATTTGTGCAAGTACACCGCTAGGCCAAG
GAACTTCCTTATTCCCTTGACATCCACTGGCACGGGCCAGTCGGTGATCGCCTTGATCTTTTTGGGATCAGGGCGTACGCCGCGTTTACCCACGATGCAC
CCAAGAAGTGTTATTTCGCTAGCAGCGAATATACACTTCTTGAGGTTGGAATACAGCTTATTTTTCCGCGTAAGTGTAAGAACCTGACGAATGTGTATTC
TATGAACCTCTACTTCAGTCTTTCCATCCATAGCCCGGCTATGGACGAACATATCGTCGAAGTAACTCAGTGAGGAAATCTCGCCGCACCGGTCTCAACA
GATTCGTTACGCATCTATTGAATGTGGCAGGGGCATCATTTGTCACTCCCACAGCATACCGCTGGGGGTGCTCACTGCTATGTACGGGATGTCCCGTTCA
CACATCAGGATCTGATATAAGCCATCCATCAGATCCATGGATAAAAAGATGGTACTTTTTGAAATACCATCTATGACTACGTCCTTCCTCGATATCGGCG
TCTGAACCGGTACCGTTGCAGCATTCAACTTGTTGAATGAGTGCACTGTCCGCCACCCTCGTGTGGCCTTTCGCACACAGAAGGTCGGAGAGCTGTGACG
GGAAGTTGATTCCCTCACATGGCTCGCTGCTAAGTGATCGGCAAAGAACTTGTCGATGGCAAGTACTTGTTCATGAGGCAGTGGCCACTACTTCATGACA
CAGTACTTCGAGCCTGGTTTCAGGTCGATTTTATGACGAGTGCCTTGCTCCTTAGGAAACTCTCATGGTACTAATTCAGGGAATACTTCCTTGAATTATC
TCAAATCCTTACATAAGGGATTTGTTTGAAGCGACTCCCAGGATTGAGACGTGTACCGCTCAATCCGAGTCTTCTCATCGAGAACACTTTCGTCC