Description :
From Genome Similarity Track
Location :
Scaffold_54:6111- 9107
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15775chromodomain protein

Sequence
2996 bases(100 bases per row)
ACTCTACGATATTGTACGGAAATATGGAGGTTAGAGACTTGAGTTGGGCGATGATCCACCTGCAAGGGTACCGCCACTCAAGATCAGGATTAAGGCCAAT
GCCACCCCGTACCGGTGCAAAGTCCGGCAATACAGCCCAAGCCAGTCAGCTTTCCTGGAGAAATTCAACAAACGGCTGGTGGAACTAGGCTGGGTGTATG
AGAATCGCGAAAGTTGCTGGTGTTGCCCAGCGTTACCCGTCCGGAAGCCGAATACTGATGAGTTCCGGCAAACTACTGATTACCGACCACTAAACGCAGT
AACTGAGGCGATCGCTGGTGTGATGCCCGGTCTGGAGGTTGCACTTGAACACTGCAAGGGCAATATGTTCTACGCAATATTCGACTTCTTGAAAGGCTTT
GGTAGCTAGCTGCCTCTGTCCAAATGCAGCCAAGAGTTCCTTTCATACATGACGGACAAAGGAATCTTCACGCCTACCCGTGTGTTTCAAGGCAGCATTG
ATGCTGCTTTGCACTTTCAATCTACTGTGGAAATGGTCCTTGGAGACCTCGTGAACAAGTGTGTGATTGTATGGATCGATGATTTACTGGTTTTTGCGGA
CACGCAGGAGGAATTGGTGAATGCTATTGAAGCTGTACTCACGAAGCTCGATGAGCACGGTCTGAAACTGGACCCAAAGAAAAGTGCACTATTCCTTAAG
GAAGTTAGTTGGTGTGGTAGAATTAACAACCAACACGGAATCGGCTACGACCCTGAACGCGTTCAGGCTCTTCGTGAAATGCCATTGCCGACTACAGCAG
AAGAACTTCAGCAGTTTTTATGCGCTAGTAACTGGATGAGAGCTGGTCTTGTTGACTACGCTAGAGTATCTAGACCACTTCAAGAGCGTCTCGACGAGGC
ATTATCAGGGACTAAGACAACAAAGTGAGCAGCAGCTGGAGTGCAGATTGACCTGAATCCAGACGAACAAGCAGCGTTTGAAGCTGTCAAAGATTTGCTT
GATAATTCCGCAATGATCACGTACCCGGATCCACCCAAACAGCTCGCCCTGCTCTCCGACGCATCAGATCGAAGCTGGGGTCTAGTAGTCTCGCAAGTGA
CCGACTGGAAGCCCGATGTACCTATCCACGAACAAAATCACGAGCTCTTGGTGTGTATGGGTGGAAGTTTCACGGGATCAGCGCTCAACTGGTCTGTGAT
CGAGAAGGAGTCCTATCCTATTGTACACGCCTGTGAGAAACTGGAGTATCTGCTATTGCGACCACAGGGCTTTAGGCTCTACTGCGACCACCGCAACATC
ATCTACCTATTCTGCCCGAATAAAGAGTTAAAGCGACACGTACGCGGGAAATTGCTACGTTGGTCGACGAAACTCCTGGAGTATAGGTACTCTATTGAGC
ACATCGAAGGTGTCCACAACGTGTGGGCGGATTTAATTTCACGGTGGGGTGGCAAGCCACTGCCTGCAGCACGGATTCACTCTATCAAACGGGTTACGCG
TTCAAAACGCCGCCGCGAGCGACAGCAACGCACGGTGCAGTCGCCACGCCCACTCGATGCAGATGGCTTCGTTTGGCCGACGATAGACGAAATTGGCAGC
ATGCAAGCTCTGCACGAAATATGCAAAGCTCGATGACAACGACCTTTGGCGACTACAAGATAAGATTTGGATTCCTCGCGAAGCCAGCGATCCGACTCAA
CGGCTATTGGTTATTGCTCATTGTGGACGGAATGGACATCGTGAAGTACATGTGATGGAGAATCATGTCGGCCGTTTGTTCAAGATTGCTGGTCTCAATG
AAATGGCGAGGGATTTCTGCGCGAACTGCCTTCTTTGCTTGCACGTGAAAGGAGGAACGGTTATTCCACGACCTTTTAGCGAAACCCACCACACATTTGA
AAGAAACGCGACCCTGCACTGGGATATTCTAACGCTGGGATTCCTTTGGCGCTTCCCGCTACGTGTTGGTTCTGAAAGATGAAGCCACACACTTTGTCGA
CCTCGTGGCCTGTGACGACCCTACGTCTACCGTTGCAGCTACCGCGATCCTCGACTGGTACAGTCGTTTTGGTGCACCTGAGCTCTGGGTGAGCGACTCG
GGATCACATTTTAAGGCAAACGTGATCGCCGAACTCAGCAGGCGACTGAAAGGACGTCAAGAATTTATTTTGGCATACTCTCCGTGGAAAAATGGATCAG
TTGAACGTGTAAATCGGGACATTTTGCAAGTTTTGAAAGCTTTGGCATTAAAATTTCGCGTGAGTCTACACGACTGGCCGTGTTGCCGCTGGTGATGTCC
AGTATCAACCACTCGCCAGTCGCTTCACTAGCCAACCGTGCACCTATCGAACTGTTCACTGGTTTACCATGCCCAAACATCTTGAACACGGTGTTTTTTT
TCCTGGGGGGAAGGGACGTGTCGCTACACTAAGCAGCCCAAGGCCAAATACAGAGAAACAACTTACTGCTCTACGTGAAGTCATCGTGGTTATGCACAAG
GCTGTGGAAACTGAGCGTAAGAAACAGGATAAGAGGTACAGAGCAAGGTATCACTTCAAGCAAGACGTGAACTTCTCAGTCGGTGATTACGTGTTGCGAT
CACGTGTCGATAAGAAACTACACGCGAACAAGTTGGGCATCATGTGGGTTGGTCCATATCGTATTGTGGCAAGCACCGACTACTATTTTACGGTAGAGCA
TTTAGTCAACGGCAGCAGCATGGATGTGCACCCATCACGCCTCAAGTTCTACGTGGACGACGCGCTCGATATTTCCGAGGAACTACTTGACCACATCGCT
TCACAAGGGACTCTGCTGGCGGTTGAAGCAATCGTGGAGCATAGGTTCAACGGGGACATGGACGCCTATGAGGTGAAAGTGAAGTGGTTGGGTTTTGAAC
CCATCGAGGACTCCTGGGAACCCCTGACGACAATTAGCGAAGATGTATCTCAACTGCTGCTAGCATACGCAAAAAACGCCAACGACGATGGATTAC