Description :
From Genome Similarity Track
Location :
Scaffold_888:6110- 8438
Transcript NameFunction/comments
Phyag_g8561hypothetical protein PHYSODRAFT_558953

Sequence
2328 bases(100 bases per row)
TTGAATAGTGTCCGCGCTTCAGTTGCTTCGTGTTCGTTGCTTATGAATccactttttgctgctgtgctctcTTACCAACCGGAGattcgactgctgctgc
tagttgCCCCATGAGTGACGCATTCAACACTTTCCTCGAGCGTTTAGGCGGCATATACGAAGAGGCTGTTCCGAATGGATACTGCTACCTCATTCAGTGA
AGGGTGCCAGCTAGTCTGCAAGATCTTTTTCGAGAAATCCAGTGCATCAGGGTCACCTGGAGCAGGAATTGCTGCTATCTGCTGCGCGAGACCTCGCTGT
GGCATGGAGTGGCGCCGACTCACTCGCGCAGTACGAGGTGTGATGGAAATGTCGGCACGTCCATAGCGGTCATAAATATGGAACTCGCTATTGTACGAGC
CCGTGATGAAGTTATTGCCGTCCCCGCTGACCGCGCACTCGAATTTGTCGAAAATACAGTCGCTCTCATACAAGTCACCCAGTCGCGGCCGTAGGTGCTC
ATGAATCTGCTCACCAACAAGTACAACACGAGCCAATTAGCAACGAAGGCCATGCAATTATTTTGACAACGCCTTACATTGATCGTTTGAACTGGCCGCG
AGTTCATGTTGATGTCCCAGACTTTCAGTGTGAGGAAATCGCGCGCGATAATGTATCGACCGTCCGGAGAAAATTTGATATCCGAGATAGACGCGATGAT
CTCGGAGAAGAAACTCCGTGACTCAGGGTCTTCCTGTTCTTCAAAAACTATATTCCCGCCCAGTTAGCaccgcaacaacaacagtgTGTGCAATATAGTC
AGCTTCTCGGTGGTATGGCCAACGAGCGATCCGCACCTTGAGAGTAGGAATCGCACAACGCTGCCTGGCGCATGTCGCCGAGCTTAATGGCGCCGCGACT
CGTGCTGTACATCATCGTGCTGCAGTGCGTTGGGTGGAAATCTGCGGCTGTGATGACCTCAgtgagctcctccatgttAGCTGGCTTGATGTCCACAATA
TCTACATAACCACAGTCCGTCATTAGCGTAACATCCAGGGCCCAACTGGCATATTACTTACTGAAGCTTTGGTTGGATATGCCGAGGCTCCACAAGTTCA
CGCGAAGGTCGTCTGCCGACATGAAGGTCTCTCCGTCGCTGTTGATCGCAATCGAATTGATGTGGTACGTGTGCGCGTTTGCGTACACCCTTTTAGCTGT
AGACGTCGTCACTTGTCCACGAACGTGCGTGTGAGGCAGTCGGATGAGCTCTGGTGTAATTTGCGTCCGCGGCACGTGGGCGAGTCCCTGTTCATTGTAC
GTCGTGACCTCTCGGACGCTACGTTCGTGCACCTTCCAGAGTTTGATGGTTTTGTCGTTTGTGGACAGCAGACAGTGGGAGCCATTGGAAGGTCTGCACC
ATTTGATTTggttgatcttctcctcgattTCGAGACTCTTGAGGTAGTCAAACTCGGCGTTGTGGCTCTGGTACTCGGTGTACAATTGGTATCGCGGGTC
GCTCGTGCCGCTGTAGATATTTTGATTCTGCATTAGACGGCCACCATTAGCAAAATATCGCACTAAAATAAGCTAGCACGACTACCTACGGACCGATGCA
GGGTTCCCGTGGCGATAGTAGATGGAGACTCGTCCGCCTTTGTTGCCTGTGGCTAGAAAGTCTCCCGACCGGTCGTATTCAATTGCTGAGATCACCTCGG
CTGCACGTCAACAGATATGAACGTTAGCACTTCACATCAGGCTAAATAGAAGACGTACGTACCTTCGACAAAGCTTCGCGTGCTTTCCCCGGCTGAGAAG
ACTTGGCCCCACTCGGCGTCCGCTTCGCTTGTGGGTTCTGCCATGTTGACTTCCAATCCGCCGGCGCTGTGCTTGAGTTTGGACAGTCTGCCCTCTTCAC
CTCCGGCGTCTGACTGCAGCGTTGCTTGCGTCATGCAGTTCGTGCCGGCCTAAACGCAGGGCTCTCCTCTGCtgtcgctcctgctcgtgctcgtgtgggc
tgagctgctgcttgggggggggggggggggggggacgATCCTTTTCTCGGATCTCAGTCAAAGGCCGCTGGGCGGGAGTTTCGTTTCTCACTCTGACAGA
CAGGCCCAAGAAAAAAACACGCCAAGTCCGCAGTGGAGAGCAGTGGACAACAGCAGGGTGGCGCTGCAAATCTCGCTCGATCTGGATGACACGCACGCAC
GCTTTCAAGCCGCGCAAAGGTTTGTCGGGGCAGCTTggtctgcagcgacagcggacTTGGGAATGAAGGAGGTGTCGGCATCGCGATCTTCAATTACCTT
TTGTTCCACGGATTGTTTTAGCCAATCA