Description :
From Genome Similarity Track
Location :
Scaffold_609:6110- 7680
Transcript NameFunction/comments
Phyke_g10435Amino Acid/Auxin Permease (AAAP) Family

Sequence
1570 bases(100 bases per row)
ATAGAAGCCTAGGACTCGTGTTCAGCCGTGTAGTTGTAGTAAACCTGGTTCTCGTACTTGGAGTCGCAGTAAGGGAACTCGGTGTCATCGTCCGTTGGCG
CAAAGAGGGCCTTGCCGGTCGTGTAGGTGACGTAGCAGCCCAGAATGAAGCAAATAACGACCACAATGGTAGCTGCAACCTTCTCATACATGGGGACACG
TGTCCACGCCTTTATGAGGTAGTAGATGATCGGTAGCAAGATGCAGTTTGTCGTGATGCAGGACGCACCCACGAAGTCAGCGAAATCCGAAAAGTGATCT
TGAAAAATGACGGCCAACACAACGAGGATGATAACGATGACAACACGGAGCACAACGTACTTGACGGTGTTTGATCCGCCACGGTACTCCGCCGCCTCAG
CTTCTGCGTCGTCCTTAAACTCTCGCTCACTGTCAGCCACTGAAACGTAAGACATTTTGGAGCTTCGTCGAGGCTCCGATTGAACCTCCGCGGGAGTCAA
TGATTCGGTGTAGTTAAGACCAGCCTCAATGTCCGTCGCttgcttcttgtgcatccCTAACGCCAAGCGCTCCGCGATAAAGAAGGCTGGGTTCACGATA
ACCGAAAACGCAATGGTAATATGCAGCTGCATGAACAAGTATGCCAATACAACCGCACCCCAGCTTGGTTTGAAGCCCAGAGTGGTCATACCGGTCTCCG
AGTCTGGGTAAATCGTATACAGCAAGTTACCGGAGATCTGGCAACCCACCGCGGAGTACGCTGTGCTAGCGAGCGTCAGGAACAGACACGAAATAAAAGT
GACTGTGACTAGCACGACACGAGGCATGCGCGTCGGGTCACTGTGTTGACGCTGCAGGTCCGGGATGACGATACCAGCGCCGTACGCCAGCGCCAAGTTA
CCGAAGCAGCCCACAACTTGCGAGAACTTGAGATCGGGGGACGGTACAGTCGGATGGCCTCGCATGCCATGCATGACGACTGCAACGCCGATAACGTCGG
CGATGATGGTGCCCATGCAACCAGCGAATGCGGCGCCAGCGCCCTCCTTAAGGGTCGGAATGAGGCAAACAGGCAGCACCATGAGCGCCATGAGGATAAT
CCAAGTGGTCTGGCTGAAGGCTTCCGAGAAAAGACCATCCAGGAGCGAACCGccaagcaccaggaacacgCACGGGATAAGAAGGCAGGAGCCCATTTGT
GAGACAACGCTCAGCCAGCGGCCCCACTTGCCCATGCTCCATTCGCCCAGATCTCCAAACGTCTTGACAGACTTGGGGGCGAGTAGCATAACTTGAGACA
TCTTGACTGAGGCGTAAATGTTAGCGAAGGCCATGAAGAGCATggcgatgacggcgatgGCAGGGCCAGCGCGCGAGAAATTACCGGGCATACCAAGCGT
ACCAATGCCGTACATACAGCAAAAGAGGTTGAAAGACGTCTTGGCGTCCTCGAGGGTGAAAAACGGCATCTTGGAAGGTCCGAGGAAACGACTTGAGTCA
GAGGAGGCAAAAAGCAGAATGAATGGGTCGTAGTGAACTCGAAGCTAGTTGAAGTCTCAACTAGCGAATA