Description :
From Genome Similarity Track
Location :
Scaffold_389:6107- 7552
Sequence
1445 bases(100 bases per row)
CGCTCGCAAACGATGACTTTCATCTGCATCACCTTCACTGAAGTGATGCGAGCGTTCACGGTGCGCAACTTCACGGAGCCTGTGTTCGTGGGGATCTTCG
CGAACAAGTACATGTGGTTTGCGGCCGTGCTCTCCGTGTGCCTGACCATCCTAGTTACCAACACACCCGCAGTCATGGACGACATTTTCGGGTTCGCCTA
CATCCCGTGGTTCCAGTGGCTGGTGTCGTGCATTGGAGCAGTGAACGCGGCCTTCTGGGGGGAGATCCTCAAGATGTTCATTCGGCGACGAGACCGCGAG
CGAGCGCGCTGGGAAGAAATGCGCGAGGGGTTTGAGGCGGTGCTTCTGGAAATCCGCCATGTGCGCCACCACGTCGAGAGACTCGAGAAGTAAATCATGA
GAGCATTGGTACCTAAGCTTATTGGACACCGTCAGCAAAGTGTTTGGGTTGGTTGTTCCTCGTTGACTTGGAGCGCTTCAATATCTCACCATCTTTCGGA
TGTCTGTTGGCACTTTTCTCCAGGACAGGTGCCATTCCCTATTTCGCCGCAAGACCACCAAGTAGACCATCCGATGGCTGTCAAGGGTCGGAAGTGGACG
ACTCTGCTAGTTGCTACATTCGTCGCTATTGCAGATGCCGATACCGACGTCCCCAACTGGGTGAGCCCGATCAATGTGACAGATTCCGCCTGCTACCGCA
AGACGTACCTGTCTTCGGAGACCTGCGCCATAGGCTACGAGTCTGATGGAATTGCATCATGCTGGGCGCAGTGCCCTTTGAACTTTCCTGTTGAGTGCGG
CGCGGAGTGTATTCCACAGAGTTCGGACTGCACTTCCGAGGTCCTGGACAAGGTCACGTCGGTTGCTACGGTGGCACTTAATGCCGCTACGGCTGGCGTC
TTCGGCGAGTTCATCAAGGCCAGTAAAGCCCTGCAGCTCGGTGTCAAGTGCGGCCAGTCGCTCTTCGCAGCCACAAGCTCCCTTGTGAGCTATGTGGACG
AGCTCCAGGCTAACGCAACGCAAAGCGAGCAGCTACTGAGCGTGGTGAACCAGTCAGATCTCGTCATCAACGAGCTGCCTGCGGCTGTCTGCACGTGCCT
CGGACTCCCGGTGTCTACTGACACGTTGGAGCTCAGTGCTGACGTGGTTGCTGCCGTCAACCAGATTGTTACGGAGGTGGTTGAGAATGGAGCATCGCTG
CTTGACCCCAGTACGTTCTTGGCGCTCATGAGCGACATTGGCGTTGACGACTCTGTTCAAGACCTCGACACGGACAGCGTCGCCCAGCTCCAAGACGTTC
TAACGGCGGGCACAACGTGCGGCACCAAGCTGCAGACGATTATCCACAAGGTGACGCAGTTCGTGGCTGGTATCAAGACCAAGGACCCCAGTAGCACCGT
CAGCAATATCCGAGAGGCTCTGAGCGTCTCGGATCTCTTCCTTCA