Description :
From Genome Similarity Track
Location :
Scaffold_19:61065- 62106
Transcript NameFunction/comments
Phyta_totarag1127conserved hypothetical protein

Sequence
1041 bases(100 bases per row)
GgatttgacttggtttctGTATGTCCCCCGAATTTTCGACAAATCCGATCCCTAGCCAGTGAGATTTTCGGACCGAAAGCGTTGTCAAGTCTCAATTCGA
CAAGTGTCCGGCGGCTGTGTACGCCCCGTGGCGTCCAGACATCCTCCAAGTCGCGCGAGCACCTCTTGATAACCGCCATCGAGTGCGCAACATGCCAGTC
GCTAATGCCACAACCAGAGTCAATACTGCGTGGACCAACGACGAGTTGTTGAACCTGGTCCAGGCGTgggaggaggtggtggacgaccCGAAGGACCGAC
TGCTGCTCTCGACCGGAGAGCGCTCCACGTTGCACGCGCGGTTCTGCGCCATCGCGGGCTCCAGCAAACGTAGCTTGTCGTCGGTCACCCGCCAACACCA
TCGGCTGTGCACATCGTACCGGTTGATCCTCGAAACCGACAAGAGAAGTCTCAAAAAGGGGACCCCCGGGTGGTTCGACCTGTCGGCAGCCGAACAGCAC
GAACTACGCCGCGCGCACAATAAGAAGGAGAAGGGGATGACGGTGGTCAGTCCCGAACTCTTTTGGAGACTTGACCGCATCTGCGGGGGCAAAGGCGCCG
TCGCATCGGCATCCCCATCCGGAACCAAGAAACAAAAGGTGAAAACTTCCGCTCGGAAGGACGGGAAACAACCCAAACGTAGTCACCATAAAAAGAAAat
tgtcgacgtcgaagaggAAACGGGTGACGCATTGAAAagcacgtggacgacacgCGACTGGGCGTTGTTCGTGGACGCGTGGCAAGAAGCAGTAGACGAG
TTCCTCGACTACGGCAACGAGCcggacgagaaggtgaaaTTGCCCAATTGGTTGATCCAACAGAAGTTCGTCGCACTTGGTGGACCGCAGGACACGTCGG
TGGGCTCGATCACGGCCAAGAAACGGTGTATCATCCACTCGTATCACTTTATCCGGCAGTGTGTGTCGGGGTTGGCAGCGCTCGACGGGTCGGATTGGTT
CGAACTCACTTTTAATGAACGATTCCGCTTGCAGCGGAAGC