Description :
From Genome Similarity Track
Location :
contig_5:61059- 65679
Transcript NameFunction/comments
g1298.t1hypothetical protein
g1299.t1hypothetical protein PHYSODRAFT_553039
g1300.t1AGC/MAST/MAST protein kinase

Sequence
4620 bases(100 bases per row)
CGCAGCAAGTTACCGGCCAACCAAACGTCAACTAGCTTGCAGCATGGCTCCGACTGCTGGTATGTCTTGCTGCGTGTGTGTACCTACCCACCTCCGCTGC
AATAACGTCTAACATCCCTACGCTTCCCTCTCGACCGCAGGCACCCGTCTCCGCTTCAAGAACTCGCAGCCCAAGAAAACGCAGCAGACCAAGAAGGTTC
CGTCGCTCAAGAATCGCATCCGAGGACTCGAGCGGTTCCTCAGTCGCGGGGTGCGTTGGCTGCAATTGCGAGTGTGGAGCGTTGCATCATTTGTATTGTT
TCTAATATTTTGCGTTATTGGTGATGGTGGTGCAGGGGCTGGCTGATGCTACGCGGAGAGCCAAAAAGGCGGAGCTCCAGCAGCTCAAGGAAGAGGTTCG
TGCACTTCGCATCATAATATTTGTAGTTATGCAAATAAAACTAAAGTTGTGGTTTGTTGATGGTTGGGTAACAGCACGAGCAGAAGGGAAAGGTCGCAGA
GGAGAAAAGAATGCCGAGAAGTACAAGAGGGTGAGTGCACGCAGCCAACATTGCTACGTAGCAACACTCGGGGCGTTTTGATGAGGTGATGTCTGACTTG
GAGCTGGTGTTGATTATGTCCTAGCCGCGCTTTTTCGAGCGTGTGAAGGTGATGCGGAAACTGCGTCAGGCTAAAAACCGCCTTGAGCAGGTGAGGAAAT
TTGTTGATCACAGAGTCGCAAATATGGGCTGAGTACGACTCTAATATTTGTTCTGGTCGTAGGCAACGGATAAGGCCGAGCGTAGTGAGCACGAAAAGAA
ATTCCAGACGTACCGCGAGGAGATGATGTACATCTACTACTACCCGACGAGCGAGCCTTACATTTCACTGTTCCCGTCGACACCTCACTCGGAGAAGAAC
CAGAAGCGCCAGAAGGAGATTCGTGTTGAGGCGATCGCCCGTTTCGAGGAGGAGCAGCCTACTCAAGAATTCCACCACTTTTGCTTCAAGACGAAAGATT
CTGCCTCTGCAGGTGAAGCTAGACCGGTTGTGGAGCTTCTGCTGAAGAAGCCCAGTAAGGAAATGGTGAAGAAGCAGAAGAAGGCCCGCAGCAAACGTGA
CAAGTCAGGTGAAAAGCCGAAGCACACTCCAGCTCTAGTTGACCAAGATGACGATGATGAGGTGCCGGATGCATCCAAGTCGGAGAATGAAAAGGAAGAG
GAACTGGAGGAGGAACAGGAAGAGGACGACTTCTTCTTGTAAGTGTCGGTACAGAATATAGTTGCAACGAGTCGGGTCGTTGCTGTTCACATCTGTGCAG
ACAACCGTACGTTCAAGGTTTTCGTTCTTGCGATTTATTACTTCAAAGTACTAATAGTCTTTACGCTGACGAGCTCATAAGGAGGAGGAGGAGGAAGACA
ACTTGGACACGAGAAGTCTGTAGAAAAATATGAGGAGGAAGCATCGGACGATCTCGAAATTCAGCTAAATCAGAATAGACGGAGCGCCCGCCGTGCTTGC
GGTTTGCTGCTCTGTGTCAGTGATCATGTCTGCTTCAGCTTGCGATGCAGCCGCCAATGCGTTCATGTTGGTGAAGCTGAAAGACCTGAATGCATCTGAG
AGGTTGGAATCTTCGGGACTACCGTACATTCCACTTGGGAACCGATAGTGACTATTGTTGTCTTCCATCGGCAGTCCGTCGCCCATGTATTCGTCATGAG
TAGCATCCACTGTGTCAAGTGCATTTAGCGCTCCTGCGGTCCCCCACGACATGTCGACATCCGCTGTACCTGCAGAAGTACAGCTTGCGTTGTTGTCACC
ACTGTCACAATCATCTTCTCTTTTCGGGTCAGACGAACTCAGTGGCTGATCGTCATTCTCAGGCCCAGAGTCGATGTTGTTCTGGCTGCTACTGGCGGAA
CGGGAATCGACATCAAATTCGTCGTCGTCGATGAATATATCCGTGAGATTACGGTTGTTGAAATAGCTGGTGTCGTTCGGCCCTTCCAGTGTCGGTACGA
ACGGAGGTACAGATTCCAGGATCGTATCCCAATTGATACCATCGAAAAAGGGTGCAGTTTGATCCCCTCCCAACCCATACGGGCTGCCGGGTTCGGGTCG
AGTAGCTTGTCTATCAGGTCCACCGCCTCGAGCGACAAGCACTTCTCTCCATCGGGCCACAGAATTTGCCGCTCGAGAATATTCCCGAAGATCGCTTCCA
CAGTGTCATCATTGAACGGAGGAAAACCAACCAGCATTTCATAAAGGATAATTCCAAGAGCCCAGTAATCCACGGGAGGGCCGTGAGGGACCCTACGAAT
GATTTCAGGCGCCAGGTAGTCCGGAGTACCACACCGTCCATACGTCTGATATGCAGACTTATTTTTCAAACTCCTTTTCGCTGATGAGGTGTGGCGTGGA
CGGCTATGTGCTGGAGCAGACGGCGTGACTCCCAGTGGAGTGTCGGGTAATATATCCGAATCCTGGCCATGGACTCATCGTCAGGTTCCGAATCCGAGTC
ACCAATTGTCACGGCTTCCTCGGACAAACCGAAGTCGGTCAGCTAAAATGTGGAAGAGAATTCCAGTAGCGATTAGAGGTGAAACGATAGAGACGAGAAA
CTGTATACAAGTACTAGTAGCTGCTAACCGCACCTTAATGTGTCCGGTTGACGAGAGCAAAATGTTATCGGGCTTCAGGTCTCTGCATCATCATATGCCA
AAAACCAGGCAAGTGGATAGACAGACACATGAGTGATCGATCTATGATAGCGTGCAATAGCTGCGAATTGAACTGTCCAAACCTGTGGACGCAGCCTTTA
GTGTGCAGGTGATTGAGCGCGATTGCGATCTCCGCAATGTAGACGCATGCCACCTGATCAGGGGTAAATCATAGTTCGTTAGCATCATTGATCGTACTTT
TTGCAACATGCACACAAGCTCACCTGCTCTTCCAACTGCACAATGCACTCCAACAAGGACATGAAATCTCCACCGGGAAGATATTCCATCACGAGAAAAA
GGTTGCGCCTAGCGATGTCACCAAAAATAATATCAGGTATGAGCTACGCGGGTACTATGAGCTTAGTGCTGCATGTACTGCTTACTTGGTTTGAAACGTC
CAGAATAATTTCACGACGAATGGACTCACGACGCTGGCGAGTATGTTCCTCTCTGTTTCGATCTGCTGAATCTGTTGGTGGCACACAAAGCGAGCAACAG
AGCAAAATGCTCAGTAGGCAGCCCTGTGATAGCAACCATCCCAGGCTGCAGGCAATGCGCTGTACCTGCTTTTTGCGCAGCAAGTGCTCTTTTCGCGAGC
ACCTTGATCGCATACTGATCACCAGTTGTCTTCTTCCGGGCGAGATATACTTTACCGAAAGCACCTTTCGAAATAGGCTTAACAATCTGGAAATCACGGA
TCGAGACACGATAGGAGGCTGGCTTCAGACTCGCCCGGCGCGGTGCTCGAAAGCCATCGCTGCTTTCGATATTCTCCAGGGACTTGGTGCGTTTTAGCGG
CGTTCGCACTACCTCGACGGGGGCTTGCTGGAACATCACCTTCTGAGATGCTCGCATTTTGCTCATTTGGCGTGGATCAAGTTGCGCAGCTTGGTGCAGT
ATTTGATCCCGCGTTCGACGGCAAAGTTGGTGTCTCGATCTCCTGTTGTCGTATTCTATCGATAATTTTCACTAGACGTGCACACAACGCAAACGCGTCG
ACACTAGTCACATCACAAGTCGAAGCCTGGATCGCCACTACACGCAGTGCGTGGTAGATGTGCATTTCCTCCTGGTCGAACATGGGTCGCATGGCCTGCG
CGCTCAGCGTGGCGTTAATCGAGGCCGTGAGCTTCACCAGCGAGTTGTTAATCACATCCGCTTCCAGCTCCACCCTCTTGGACAGTACGCAAAAATTGGT
ATGTTCGTCCAAGCTGTTGGCGTCCACTTTCGTCTCGCAGAGCTTGCACACGACCACGGACTTGTTGGCGCGGTGGAACGTGACCGTCATGGTCGTTTAC
TGAACTGCAGGTTGTCCAGCACGTCTTCGGGGACGTGGCGGCCATGTCCCGTCCATTGATGGCGTCCACCATGAGTCCCCTCGTGATGGTCACTCCCGGG
GAATGTGCATGACCACCGTCGTCCACGTCTCGAGGTGGACGCTCTTGATCACGACCTTGTTCTTCTGGGTGTCAAACACAAACTCGAGCCCCAAAAAGCC
GTCCCCGAACGTCACGTCAAAGGTCTCACCCCTCGGACGTCCTCAAACAGGTCTCCTCCGTCCTCGAGCATGGCCACGCCCTGGTCGTCGTCCTGGTTGC
CGTCGCTAGATGCGAAGCGGCGCCACTTGACCTGGTTCTTCTCCCAGCGGTTCAGCACGTCCTCCAGCACGTCCGGAGTGGCGTCCAGCAGCCCACTGCG
ACTCATGGAGGCCCCGCGCCGCTGAAGGGCGGCACGTTGAGCGTGTACTGGCGCTGCAGCCGCTGGGGCTGGATCTCGAGACGTAGCTCCTCATGGATCC
GCTCCATGTCGCTGCTGCTGGTGCTGCTGGCGCTCGGGCGGCGCCCGCTGCTGTCCGTGGGGAGCTGCAGCTCGGCCACGCGGGCCAGGGCGAGCTGCTG
CAGCGCTCGGCCATGAGGAA