Description :
From Genome Similarity Track
Location :
scaffold_81:61049- 62576
Transcript NameFunction/comments
Pl_110243copper-transporting ATPase, putative

Sequence
1527 bases(100 bases per row)
ATTGAACTGGTCCAGCGTGGAGATATCCTGAAGGCAGTTCGTGGATCATCAATTCCGGCTGATGGTGTCATCGTGTACGGCGAAGGTCGCATCGATGAAT
CGATGCTGACAGGCGAATCCAAGACAATCAAGAAAGTCACCGGTGATCGTGTGTTAGGTGCGACCGTCAACGTCGACGGGTTGTTCCACATGAAGGTTAC
TGGTGTGGACAATGACACTGCACTAAGCCAGATCATTCGTCTTGTGGAAGACGCACAGTCATCAAAAGCGCCAATTCAAGCTTACGCCGACTACGTTGCC
TCTGTCTTTGTCCCGACGGTGCTAGGACTGTCGTTCTTGACATTCTCGGCGTGGTACATCCTTTGCATCTTCGAGGTTGTTCCAGAAAGCTGGATCCCGC
ACACGGACAGCACATTTGTGTTCGCTTTTAACTTCGGCATTGCGACGCTCGTAGTGGCTTGCCCATGTGCGTTGGGGTTGGCGACGCCTACCGCTGTTAT
GGTTGGAACTGGCGTCGGCGCTGAACATGGTGTACTGATCAAGGGTGGTGAGCCGCTGCAAGCTGCACATAACGTCAACACGATTTTGTTCGACAAGACG
GGAACCCTTACTGTGGGGAAGCCTGTGGTGACAGATGTGGTGGTGCTCAGTAAGAAGCTTACCACCGAGGAGCTGATTATTCTTGCTGGATCGGCTGAAC
TTGGTAGCGAGCACCCGCTGAGTAAGGCGATCATCGAATACGCGAAATTCATCTCGTCATCTCTCGAGCAGCCAACAGGCTTCCGCGGGGTTTCTGGACG
AGGCATTGCGTGCATGGTCGGTGAACACAAGGTGGTGATCGGGAACAGGGAGTGGATGGCAGATAATGGCTTGAAGCGTTTGACCAGTATTGTGCTGCAA
CAGGCCACGGTGACTTTCCAAAATGCTGGAAAGACAACGATTTACATGGGCGTCGACGATGAGCTCAGTGCCGTCTTTGGTGTGGCAGACGCTCCTCGCA
AGGAATCGATTCGTACGCTGAAGAAGCTAAAACAAATGGGTCTGGACGTTTGGATGGTCACTGGAGATAACGCACGTACTGCTTTCACCATTGCTGATCA
ACTTGGAATCAGTCGTCGTAACGTCATGGCCGAAGTGGTCCCTTCCCAAAAGTCTTCAAAGGTCAAGCAGCTCCAGAGCACTGGTCGCATCGTCGCCATG
GTGGGCGACGGCATCAATGACTCGCCTGCTCTAGCGCAAGCAGATCTAGGTATCGCGATTGGCGGTGGCACTGAGATCGCCGTGGAAACAGCAGGTATGG
TTCTCATGAAAGCCAATTTGTTCGACGTTATCACAGCTCTAGACTTGTCCCGAACGATCTTCAACCGCATCCGCCTGAACTACGTGTGGGCTTTAGGCTA
CAACTGCCTGCTGATCCCGTTGGCTGCTGGTGTGCTGTACCCCTTCGGTTTCAGCATTCCGCCCATGTTTGCAGGTGGAGCTATGGCCATCTCGTCCGTG
TCGGTGGTCACCTCTTCACTCTTACTT