Description :
From Genome Similarity Track
Location :
Scaffold_111:61045- 62144
Sequence
1099 bases(100 bases per row)
AAGACGCTCACAAGAATAATGGTATTCTTGTCTTCATAGACCGATTCAGCAAGATGGTACATCTTGCTGCAGTAAATGAGTCAATCTCAGCACATGGTTG
TGCCCGTGTCGTCATTGACACGGTATTCCGACTCCACGGTCTACTCCGTGAAGTCGTATCCGACCGTGACCCTCGGTTCACGGCGGAGTTTTTGCAATCC
GTGTTCCGATCACTCGGAACGAGATTGAAGATGTCAACATCTGACCATCCCGAGACAGATAGTCAGACGGAACGTGCAAACCGTGTCCTCGAAGAGATAC
TTCGAGGATACGTCCGCTCGTTCTCGAGTTGGAGCAAATTCCTCCCCATGGTGGAATTCGCCATCAATAATTCGTTGCATACGTCGACCAGCACACACCA
TTCTTCGTGAATGGCTTACGCCATCTGCGTCTGCCCATCCTATTAGAGTGTGACTCTTGGTTAAGGGGGGAGGGAGTCGCTCGAGGTAACACCGTTCTGG
CTCTTGCTCATCACGTGTCGACGCTAACGTCGTCACGTATGATGCCGATGTCGATCAGGTCGACATCGAAGAAGAAGATCATCTTAATAATAGCGATGAA
GCTATTATTGAGTCAGATGATGATGACGATGCTTTTATTTTCAGCATCGCCAACGGCTATTCCAGCGAGGATGATGACACCCTCGCTGATGAACAGAAAG
AAGAAAGAACTCTTTCTGCAGTTCGCACAAGGCGAACTGAACAAAACAATGTCACGTCAGCAGAAGGATTTCTGATGGCTCGAGAAGCAGTGGTCCGTTT
CGTGCAGGACTCCATCGCTCACGCGGTGGGATCGGCAGAAACGGAACGCTAACAAGAATGGAAGAGCAAATGTTCTTTCGTTTATTGAAGGCGATTTAGT
CCTACTATCTACCGCAAATCTACCTAGACACGTAGTGACCAACGTGGGCAGCAGTAAACTACTGCCCAAGTATATCGGCCCCTTTCGTGTGCTGCGCCGA
CAAGGCAACGTATACACGATCGAGCTACCGCGTAGGATGCGTACGCATCCTATGTTTTAGGTGGGGCGTCTCCGCCCGTACTATCAGTACGAGCCCTCT