Description :
From Genome Similarity Track
Location :
Scaffold_11:610199- 612351
Sequence
2152 bases(100 bases per row)
GTGAATTCAAATGAAAAAGAATGACTGTCATTGAAGTTCCATGTTTGGCAATACTCGTCCAAACATTGTGATTGCCTTCCGGTCAGGCGTGTCTCTGCCT
GGCCGCTCATTGGCAGCTTAAGAAGACAGTTGGCAGTCAACATAGACAAGTAGGAAGATAATTGAAGAAAGTAGGACGCATTGGTACCAACGTCATGGCC
ATCGCTGGCTGTGACGTTGGTGCGTCGTTACACTCAATGTACGCACGCTGGGTGTACACGATCTAGTAGTGGGTGCTGTCCAAAGTGATCTCGATTCCGG
AACAAGAACTGGACCTCCCTATACTGGTCAGGGGAACTTCTCTTTGCGGTAAGCTGCAACTCGCTGACTGGGATATGTGTAAACGGGCACGGAATATAAG
TTGTGGTCTCTACGACCGTATCCTGTTCAAACGATCGGGAGTGCTTCCGTAGCTGAGGCTGTACATACTTCGTGTTTGTATTTAAGGAAGTAAGACGCAA
CACACACAAGCTTGCTGTGGTTGTAATAGCCACAACAGGAACTTGAAGTGGTGTGATTGGTTGCCTGCGCTGCAGGTGCGAAATTCTGAAGTGAGACACA
TCTTCACTTCTCAGCCATTGACTGTATTTACAGATTAGCAGTGGGCCGCATGCACTACACAGTAGGGCGCCACAAGTTCTCTGCTGGACGAGCTCAACGC
GATAGGTAGGTGCGGCGCACCCTTCACTGTAATTATTCATGCTTCAATATTAGTCTTGCATTCGTGCTTCAGTGATGTAGCAAGTCGGAAGTCTTACAAA
CCTCACCAATATTATCACCGAAAAGCGTCCATCACCGACGCTAAGAGAGCGTTGATACCCTTTCTTGGTATTCGATACTGAATAATTTGCATGGAAGCGA
ACAGACCCAGGTCCAAACAGCTGATATTGGGCGAGTTGGGGGGATGACACAGTAGCTTGATGTTCCATTCTCCTTCAGTTCCGGCCTTCATAACATCCGG
GTCCGTTGGCGCTACGTGCGGTTTTGCATTGTCTTGTTGTACGAATATGATTTTACGACGATCGCTCCTTCGCCGCTTTGATCGCTGGGAATATTTTCGT
CAGAAGATAATCTTTGTATACTTCCCGGCAGACCGTATTGAAATTACGAGTACAAATAGTTCCTTTGTCTCTGTTTTTGCCTCGCCGGTTAGACTTGTAC
TGTTCCGTGAAAGACCATATCCCAACTTTGCCATCCCAACGCTGCTTTCGGTGAGGATCGTACCTAAAATTAAAGTTTGTCATTTCCAAAAATAAATTAT
ATAGAGGCTTGCCTTGGCCGTGCAAGTGCAGCTAAAAACATCGTATTTGGAATAAATCGCTTGCTCTTCCAGGCACGTGCAGGTAGTTCTTCGCGGTCGA
AAACGAAGTGTGATCGTCTGGTGCGGTCTGCGTAAAACCACTTCTCATCTATATGCACTAGATTGTGCATAGCTCGAGCTGCAAGGTTTATTCGTCGATA
AACGACAACGCTTGCTATACCCGCCGTATCTTGTTATCACTCGCTAGTACCAGCTTCATAAACGTAGCTCGCCGCATCACCATCCTTTCTTTCACTGCCT
GTCTTATCATATGCCAAGCGAGACCAGAGACCGCCGCCACACGTCTTTCAACTCCTCTATTCTCGATAGGAACTCTCTTCAGTTTGTCACGTACTTCGTC
TCGATTCTTCTGCTTTCTGCCGCTAATCTTACTAATCCGGCTAAGCCCCCCCCCACGACACCAGCCGTCACTGCAGAGCTGTATCGCTTCCACATCAACC
TCACGGTGTCTGGATGTCGACTCATAAGAGCACCAATCTTAGCAAACGCTCCACTGGGTAGTTCTCCGCTGTTGGTGATCTTTAGAAGCTCGTCAATGAC
GGCTTTGCACTCGTTGTTGGTAAGGTTGGACTTCGGCATGCTTGTAGAGGAAGTTGCAGCTTAGCGCAGGCGTGACGGGTCGCACTCCAGGCGAGGCTTG
AGACCTTGAGAGCTAAAACTCAAACGGCAGATGCTACAGAAGTCCGTTCGGCGCAAAACTGGTGGATTTAAAAAGATGAGATGCGGGGTTTTCGGGTGTC
CAATCAGATGCTGTATTGTATAAATTGAGCTGAAACAATTGATCAAAATGTT