Description :
From Genome Similarity Track
Location :
Scaffold_43:61005- 65361
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_43-snap-gene-0.65Leucine rich repeat protein
Pytap_DAOMBR444maker-pag1_scaffold_43-snap-gene-0.47HIRA protein

Sequence
4356 bases(100 bases per row)
ACGTACAGATACTCTAGGAACATCAGTGACCCAAGTGTGGATGGGAAGGgTCCATTGAACCAGTTGCGATCAAGTCGCAGGATGTGAAGCTGCGATAGCA
TCCCCAGCGTTGAAGGCACCGCGCCTGTAAGGAAGTTGGAGCTCAAGTCTCTGTGTGCATGCCCcGTGGTCAGCAGTGATCAAGCGGGCGTCTCACCAAG
ACGCACAGCTCACGCAGGTAGCTCAAGGCGGGGCGCGCAAACTCCTTTGGCAAATAGCCCTGGAGGTTGTTGTTCGACAGACGGATGGCGATGATGTGGT
CCTCTCCGTCGCAGATAATACCATACcACTGTACATACAGACAGACATCAGAGAGGCTGCATTCATTCGTCTTTAAGAAGCGTGCTTCACCTGGTGCAGA
CACGGATCGCTCCGCTCATTCTGCACGTCCCAGGTGTTCTTCCATTCTGCCCCTTCGGTGGCCCAGAAGAGCAGCTTTAGCGCGCCAAGCTCGCTTCTAC
TGGTACTGCCGTTGACGCAGCACACGGCCGCCACGAGCAGCACAAGCACTGCCATCCGCATGGTCATCACTGTCATCAGCATCCGCCACGACTCTTCAAG
GCAGCCAAGGGGTACACTCGGGGGTTACACTCAAAATGGGTGTCAAAAACCACtATACCTCCTATATCCGATGcTCTATGGTATCTAATGTCCCCAAAAc
cTCTCACATCGCATACTCCCCGCCATCACACAGGAACATGCTGGTCGAGAAGCCGGAGGCCGTGCGCCATGAGAATGCGGCGGGCAACGGTGCGTCTGCA
GGGCCTGGACGGACCGAGTGACTGGAGCTGACTATAGGGCGGCGGTGTGGCGGCTGTGTGCGTAGCTGCCGCGATCTATGGCGTCGACGCGCACCCGACC
AAGCAGCTCTTTGCGACGGCAGGTGGCGGTGAGTCCCAGTCGAGTGTCCTGAGATCCTGGCTGGAAGATGCTGAGCTTGTGCGTGTGGCAGACGGCTCCG
TGAAGATCTGGTCGCTGCAGACCGCCAGTGATGATGGCGTGGCCACGTTCGATCTGCTTGCGACGCTGGCGTTCCACGAGCAGGCCGTcAACTGTGTGCG
ATGGGCGGCGCACGGACGCTACTTGGCGTCTGGATCCGACGACCATCTCGTTCTGTTGTATGAGCTACAGCCTGGCgCACCCCCTCcAGTGCCCTTCGGT
TCGAATGCCAAGCCGAACAAGCAGAACTGGACGCGATGCTCGACGATGAAGCGCCACACGATGGACGTCCAAGACGTCGCGTGGTCCCCcGACGACAGGC
TCCTCGCGACGTGCTCGATCGACAACACGATCTGCATCTGGGACGTCGATCCGTCGGGCGTTGCTGCGGTCATGAGCCAGCCATTGCATACTCTAACAGG
CCACAATGGATGGGTCAAGGGCGTCGCCTGGGATCCGGTTGGCAAGGTACGGTCTCTGCTATTGACAACGGCCGTCGTGATACAGGATCGCTCACTGCCG
AGTGTATAAAGTACCTCACCAGCGCTGGAGAAGACAAGACCGTGCGTGTCTGGCGCGTGGACGCATGGCAGGAGGCCCAAGTCATCTCGGAACCGTTCGA
AGCGTGCGCATCCACGTCGAaCTTCCGCCGCTTGtCGTGGTCACCGGATGGAGCAGTGCTGAGCGCGACTCATGGgTTCAaGTCGAAGAaGAaCATCGCG
GCACTGCTCGATCGGTCGACGTGGTCCAacGATGTCGACTTTGTGGGGCATCAAGGCGTCGTGACGTGTACACGGTTCAATCCCAAAcTGTTCGAAAAGG
ATGTCAACTCGGAGAaGGAaTaCGCCtgCTGTGCGGTCGgaGGGGACGATGCCACGATCAGTATTTGGCTCTCCCACATGGCACGCCCCcTGACCGTCGT
GAAGGACTGCTTTGACGCGTCGGTGACAGACCTCACGTGGTCCATTCAAGAGGGCAGATCGATGCTGATCGCCGGCTCGCTAGATGGAACAGTCTGCTGC
TTCCAGTTGGATGCTGATGAGACGGGTTTTGCCGTGTCAGAAGTACGACAAAGCAAGCTACTGCAGTCGAAGGTATGGTGGTGGGCGCTAACTTGCCGTC
TGAGTAGAAACTGACTATGGATGCATGTATAGTATGGCTCACGGGCAGGCATAACACTGGCATCGACGTTCGTGGAGAACCCTCTTCAGCTCCAACTTGA
GGAGAAGACGCAGTCGAGAGGGCAGCCACCTCAGCCACAGCCAGCGACTGCAGTGACAACACACACGCTTATCCCAAAGAAGAAAGGAGCAGCCTCGTCA
GGTGGCATCAACGTCCTCCAGGCAGTGTCCAAGAAGGGAGTCAAGAAGCGAATCTCTCCTGTCCTCCTGTCCGATACTCGTTCGGACGCGACGCCAGTGG
CTGACAGTGCAGGTCTCAATCCTGCATCAGTGGCAAACAAGATTCAGAACATCCTCGGCCCGACTGTGCCGGAGAATTTGGGGGACACGAGTCTACTTGA
TGACCGTATGGTTGGAAAATCAACCAAGACAGACGACCAAGAGACTAGCACTGCAGCGTCGACTTCAACGGCAGCTACTACGTCAGTCCCTGCCAGCAAG
ACAGAACTTAAGCGTCCTAGAGACAGCTCACTGAAACGCAAGCGTGAGGGAGAGCGAGGAGTGGCGAAACCGGGAAATACTGGTGCAGCAATCATGGCCA
AGTCGAAAGAGGTCACGCCTCGCCACCCGAAGGTGCTGACCAACGGGTGAGTCATTGATCCAATTATTGATTtGTTAGCAAACTGACGTATTGACCATAG
GGAAAGCGGCGGTGCCACTGCGTCAGAACCACTTTTACCGCAACTGCCATTCCGCCTCTCCTTTTCAGTTGAATTTGATACCAAAAaAGACGCCTCATCC
GCGGCTTCCTCGGTTCTCGTCGATGTGACGGTGCACAACGTGAAGTCGAGTGAATCCGAGGCGTTGGGTACGTCAAAGACAATAGAGGGGCCGTCTAACA
CGTTTCTGATTGAGATTGCGTCTCTTGCTTTTGCGTAGATACCGATCAGGTCTATTCGACGGTGCGTTGTTCGGCTCAAGGAGAGGTGAAGTGGATAGAT
CGCTTTCCTGGACGTGTAGTCTGCGTGgCGGGCAATGCGAACGTTtGcGCCTTGGGGACAAGCACTGGTGACTTGTTCGTGCTCAGCCTCAGCGGACGGC
GTCTGTTCCCATGTATTGGTATGTTCTTTCGTGCTTCTGGGCTGAAAAATCTCCACTGAAAGCCTCGTGTAGCCATGGGTTGCTCTATAGCAGTGATGGA
ATGCAGTCCACTAGACAGCAACTACCTCATGGTCATCTTGTCGAGTGGAGCCGTCAAGATTTGGGATATCAGAGAGCGCAAAGTCAAACTCAACGACTCG
ATCGAAGCTGTCGTGGCGGTACGAGGCTCGAATGTGGCTGTTGTTGTGTGGCATCTCAAACTAAGTATCTGCGTCTGCTGCAGTCGGCGTACACAGCTCT
CCAACGTGTGACGCTCCTGCGCAGTGCATTGACGCCAACGGGTCATCCAATGATCACATTTGCCATTTCGAACCcAGAGATGAAGGGGTCGTCGAGTCTC
AATACGTATACCTTCGACAACGATATGGACACTTGGTAGGCTATGATGGCAACAGCGTGCTGTGGAAGCCGGACAACTGACTCCATGATGTGTGCTTGGA
CCTCAGGATGCGTGTGGCTGACGGTAGTTTCGTGTACTCGGATTTCAACTCGTCGTTGGTCACGGACACCGTGGTATCTCGCGATATCCCAACGGGTCCG
CTTCGTCGTCTGCAGAACGCGTCCGGATTCAGTCGCACGCAGCGAGGAGTGGCCTCTGTGATGCTCAAGGAGCTGCCAGATCCCATCACCCAGCGCAACG
TCACACGAGCGCACTTGGAGCACCAGCTCGCGACGTCCGTGGTCCTTCAGAGTTCACACGAGTATCTGTACTGGTGAGACGATCGTGTGGGGCTGTTGGA
TGGCCCAGTCCGCCTTCTTACTCTCGTGGTTGTGATGTCAGGCTCAAAGCGTACGTCCGATTCTTGTCCGTCGACGAAGACGTGCCACGCCTCGAAGAGC
TCTGTGCCGAATTGCTCGGCGCCTTCCACTCGCCGTCGCATGCTCTCACCGACACTGTGCTGGTGCGTTGTTGTTGCCTGCGATCGCTGTTCCACCGCTT
GGCCCCTCATGCGATTTTTGATGTGGGAACTGGACAGGGTTTCACCCGTCGAGAGCTTCTGCGAGCCCACGTGCTGCCGACCATGGCGTCGAACCGCACG
CTGCAGCGTGTCGTGGCCAAGTACCAGCTCATGCTGAGCGAGATCGATAAGAGGGA