Description :
From Genome Similarity Track
Location :
Scaffold_1827:610- 2952
Sequence
2342 bases(100 bases per row)
CCTCCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTG
CCTCGTCTACTTAACTGGGTTCATCATATCCACGCCAATACACCAGAAATTCACGGTAAATCCGCCCGTATCTAGTTCGCTTCCCTGTCCTCATGTCGGT
GATCTTCTCGACTTCGAACTCGTCGGCCTCTAAGTCCACATTCCAACTATCCTCCGGTAGAAGGACTTCGTCTAGGTGTGCGCGGGCGGATCCTTCCACC
AAAAGACGGGTTTGCGGCCGATCTGGATATTCTTTAACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCCGCCGTTTCCA
GCTTTACCGCATGTTCTCCTATCTTTCCGCTCACCCGGAGCGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCACTCGATCCAAATA
AAGCCACACCTGCGATCCCACTTGGATTTGATGCGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGCCGTTCGTTCACC
TGGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGTCATCGCCTTGGATCTCGATTTCTCTTCTTGGTGCTACATACTGGAATGGCCGCTTCTA
GGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATCACCTCGGATCCTGTCTTGGGTGGTGTTCATCGCGAAGGGGAGTCGTTCTGCGTA
CTCATCCCAATCCCTCTGATCCAAATCCTTGACATACATCTTGAGTGCTCTCGTGATCGGCTGCACTATGCGTTCGGCCGACCCGTTAGCTTGGGGACGG
TATGTCATGGTTGCTTGCTGTCTCTGCCCCAGGATCCGGTTGAAAAGCTCGAAAGAAATCAGTCATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCA
CTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCGGCAATGGTTTGTGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACA
GACTCACCCAAATCAACAATTCTGTGTTTCCTTTGAGCGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGAC
ATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACATTCGCCGACATATCGTTGTACGCTCTTGAATAGCCCCCTC
CAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCACCTTCTAAACTAGCGTGATAGTGGTGTAGGACACCCTGTTGTAAGG
TTTTCGGCATCACCAGTCTCATCAGTCCATCTCGATCCTCGTTGACGCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATC
CGTAGCGATGATACTGTAGGATTTGGCATCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAAAATCCACGCTTCTTCGTTC
TGTGCTTTGAGGATCCGCTCAATGCGGACCCCCTTCACAAATGTTTCCTCGAGGATCTGGGGGCTGGATCCAACCCTTCCTCTGGACCTAGTGACGGCCA
TCACCTGGACTGTCCTTTTCCCGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAATGTAACGAGATCCTGACGCTCGGTCTCTCTCTCCACTTCGAC
ACCACATTGATTCCGTGAAGCGGCACTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAAATCGTGATTCATCCAACCACGCAGG
TGGATCATCACTTTCTGCCGTAACCGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTTGCACCTGTCTGATCACCAGATTTGATTCCCACAAATCAC
CAGCCTTTTGGGATCTTGTCCCTTTAGTAGATCCAAACCTAGCAGGAGCCCGTTATACTCCGCTTGATTGACGGGTGAGGCCTTCCGCGTAAGTGGATCT
GGCCCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCGCTGTATGCTCCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACATAC
AGATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCCTTCTCATCCATCTTAG
CTCGAGGAGTGATGCTCGCGGATAAGACTCCCAGGATCTTGT