Description :
From Genome Similarity Track
Location :
Scaffold_5:610- 2259
Sequence
1649 bases(100 bases per row)
CACCGGCGCGAGCAAGTCTTCCAGGTCAACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTCTCTTTCACGCGCTGCACCTTA
AGGTGCCACTGCGATAGCAGCACTGCGAGCTGGACCGCGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACAT
GTAGCGTCTTTCCTGTCAGCGGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGACTCCTT
GAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCGTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGA
ACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAATCTTTCGAAGGAATGACGTGCCACAGAAAGGCCACCTTTAA
CGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTG
CATGCCCTTCTTGTTCGTTGGAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAG
TCCACCTTGGGTTGGCAAAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCGAATCTTGCTAGCAATCGGTCCAGCGTCGCCAGGCAGCTGT
CGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGACCGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGGCTCCCCGTTCGTAAACATGTC
AGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTTTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGC
CCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCTTCTCCGAGTATTCAAACCAACCTCCTTTAGGATGAACGAACCCCCAGAGTGCGTTGTCAA
TCATACGCTGATAGATCATCGGCGCGTTCTTTAGCCCGAAGGCATGCGTAACCACTCGAAATGTCCGAGTGCGCAGACGAACGCCGATACTTTACGCGCT
CGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCGAGCAGAACCATAGGTAGCGCTCGATATCTGTTAACAGGTCGTCGACTAGCGGCA
TTGCATACTCCATGATCGCGGTGATAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGA
TGCCCATGGACTGTCTGAAAAGACGATCAGTCCTGCACGCAATAAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAAATCGCAGCGGCACGCGCCGGGCA
CGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGATATCGCATACCGCTCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCTCGT
GGTTCTTTAGCGTCGCGACCAGACGTTCTCGGCGTTCAGTCGACAGCTC