Description :
From Genome Similarity Track
Location :
Scaffold_105:610- 2098
Transcript NameFunction/comments
Phyci_95843serine protease family S10, putative

Sequence
1488 bases(100 bases per row)
ATGCGGCGGACGTCCGAGCTGACGCCGCTGGTGGCGGAGGGCGCGCGCGCGCCCCGCCTCTCAGGCCCCGCGCGCTTTGTGCGCCGCTCCGCCACGCGCT
CTTCGCTGCTGGTGACCGCGGGCGTGGCGCTGCTGCTCACGCTCGCGTTCGTGGTGCACCAGGACGCGACGCTATCAAGTGTGAAGAACCTCAAGGGCGT
CGCGAACAACTATGAGAGACCCCAAGACTTCTTCTGCGGGATTACGAATCACGAGACGGGGTATATAAAATTACCAAACAAGAAGGACGACCactacttc
tactggttcgtcgagtcgcgcagcagcccacagaaggaccctttggtgctctggctcacgggcggacccggctgctccagcatgatggccctcctggccg
aaaatggtccatgtcacgtgcagccggatctgtccaccaggacgaacccgcactcgtggaacggacaggccaatgttatttggctggaccagcccacggg
cgtgggctactcgtacggccccaaggtggactacgactccggggagctcaacgtggccgagaacatctactggttcctgcaggagttcctcaagaagcac
ccagatctggccgaccgggagctcttcgtcaccggggagagctacggcggacactatgcgcctgccaccgccagccacatcATGAAGGCGAACATGCTGC
GGCACTCGGGTTCCGAGACTTTCCATATCAATCTGGCGGGTATTGCAGTCGGCAACGGACTCACGGACCCGGCGGTGCAGTACCAGCACAGCGTCGACAT
GGCCTTCAACTCGTACAACGTGTCGCTGCTGGATGAGCAGGGGATCGACGACATGCGCAAGGCGCAGCCAGTGTGCCATGAGTTGATCCTAAGGTGCGAG
AAGGAGCGCTCGACGTGTTTCGATGCCATGGAGTTCTGCTTTGGAGCGCTGGAAGGACCCTACCTCCAGTCGGGACGCAACCCGTACGACATCCGCGAGC
CGTGTGCGGAGGTGGACGTCATGAAGTGCTTCGACTTTGATCATATTGACGAGTACTTGAACTTGCCGGCTGTTCTGGCCGAGCTCGGTGTCGACGTGCA
CAAGTCAAAGCCGTGGCGCGAGTGCGATGCAACGGTGGGGGCGGGCTTCGTGTTCGACGAAATGGTCTCCTCCGCCAACGACGTGAAGCTGCTTCTGGAT
TCAGGCGTACGCGTGCTGATCTACGCCGGTGATGCCGACCTCATGTGCAACTGGGTGGGGAATCAGGCGTGGGTGATGGCACTGGAGTGGAGCGGCAAAA
CGGAGTTTAATAGCGCATCGAACCGTCCGTTTGCTACGTCCGAGAACCTGGATGCTGGTCGTGTTCGCGCTTTCGAGAACTTGGCGTTTATCCGTGTTTT
CAACTCCGGCCACATGGTGCCGAAGGATCAACCTGCGGTCTCGTTTGAGATGATTAACAAGTTCTTCCAAAACGAGGAGTTCTGAGTG