Description :
From Genome Similarity Track
Location :
Scaffold_1510:61- 4412
Sequence
4351 bases(100 bases per row)
CGGGAATCAGAAATGTCGTCGATGTAAAGATTCTGCGTCCTTAACACAGATGGGGTCCCCAGGAATCCCCCTGGCTCCCCCCGCTTCGAATGGATCCACT
TCCGTATGGCCTTCCCCCAGACCCACCTGTTTCGGACTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCG
TTCTTCAATCCGAACGGCATCCGGTTCCACTCGAACAGGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGC
CATGTCTAGAGAACAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACC
AGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTCGAGAAACTGATGATCTTGG
CTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTTTTCCCGGAACTGAGGTGTCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGAT
GTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCA
GCAGGTTCATTCGCCCCCGGATCCACTTCGATATCATCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCAGGCCTTCTCCCAGAT
CCTCGGCGTGTAGATCCCCGCCTTCACGGTAACAGACTTGTTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGGCCCTCTCTCGCC
TGGCAGTCCTTCTATCTTCGGGGGTTCAGGTACCCTGGTATCAGGGAAACCACCAGTTGGATTCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTTCG
GGGTTGACTAGTGTTGCCACTCTCGATAGGGATTCAGGCACTTTATCCAATGGAGAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGCTCGGCTT
TAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCTGTCCTGGATCCAACTTCCATTGCTTGGATCTC
AACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGCTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCTGGGAGCTCCACCTCTGCGGGA
GATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCT
TCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAATCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGAT
TACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGGCTTTCATGTTCCACCCACTTTAACCGGTCTGGCAGCTCCCAAGCTTCCCCGGGCTCGATC
CAGGTGGTCTTATCCACCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCATCAGGGAAACAAAGTGTCC
CATCCGCCAGATCCACCCGGCCGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAG
CAGCCTGCCAGCGTGATCTTGATCCGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGC
ACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGCTGATCTTGCCCCCTACCTT
GGCTTGTCTGAACCACTTTCCTGGGGCATGGTGCTTCCAGTATCCACGGGACTCTCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCATAGGAT
CCAGTGACCAGACAGACCTTAGGTTGATCTGCAGTGACTTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCAAATAACCACGTGCCT
CTCCTCTGTGTAGATCCAAGGTTGAAGAGACTTCGGATCTGGAAAACGCATCCACTTGGCACAAACTAGAGACCTTGGCAACTGACACTTCATGTAGATC
ACGTGTATTATCGACTGGATATAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACTTAGAACGCTCGGCTCGTACC
GGATTCAAACCCGGCGAGCGTCCTCGTTTAACATCTTCTCGGCCACCTCTGGCAACATCCCCCTGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTT
GTAGAATTCTTCCTTCGGACACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACAC
TTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGTCCCGTCCATGAGATCTCGGG
ATCTGTACATTCCACGGCCCCCGGGTACGGTATCCCCCGATCGAGAGTTATCTCCGGTCTTCGCCGTTCAGTCGTTGGATGCAGTGAGACAGACTCGACG
GTAATCCTCTGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACATGTCGAGCTGGAGCCGTAGGCGTC
GGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCAGCACTTCTTCGAGCTCATCTGCGT
CTGGAAGACGTAACAGGGTCAGCCTGTCGGCCCAGATTTGCTTCTCCCAACGTCTCGATGAAATGATCCACATGTTCCCGTAGTACCTTGGATCCCCCAT
CCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGACGATGCAGATATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATCGTCG
TGCCACCGACACTCCCAATCCAGAGTACTGGGTCTGGAAACTGCGCAACAAATTTGGCCACTTGTTCCTGGTGGATCTGCCCAACTGCCGATACCAGTTC
CTGGCTGGCGACGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCTGACTTGACTTTGCTGATCCATGTTT
TCGCTCGGTCTTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTCAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGAC
TGCGGCTGTTGCTACCACCGCTGATGAAGGGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGAGAGTTGTCTCCCTCCACTGACTCCATCTCC
ACGTCTCGTGCTCCATGTTCGTGGAGCCCTTGCACTTGTGGCACGGGCGCTTTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTC
GTTGCAGGGTGCCCGAGAATGTGTCGGAAGAGCCTGTAGCCGTCTGGTCCACTGGCGAGACCGGATCGGTTAGGCGATTACCTTGAACCCGATCTGACGA
TAATCGCACTGGCTTCTTGCTGGATCTGGCTCGATCCTGGTTGGATTGTATCCGATCACGGGTAGGGCGTTCTGGATCCCGAGTCTTCACACTCGAGGGC
GCTTCCTGTCCCCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCGGAAGGTCCCAAAATACATGGCTTCGGGACTGGGGAGGGACTCTTCTGAAACCT
TTCCGCAACCCGCGGATTTCGTATTTTGGAGGAACGCAGTTGTGTTTTTATCCTTCGGCGACGACACTGGATCCATAGTGTGCGACCTTTCTCCGGTGAT
GGACTTAACTCTGACGAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAAGTCTATCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCT
GAATCCGTAAGCAAACGTAATAGATATTTGACTGCCACCAGCTTGTTTGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGGCGTG
GATTCAGGATCCGCATGACAGGATCTTGATGCAGAAAATCGCGTAGAGCTT