Description :
From Genome Similarity Track
Location :
Scaffold_775:61- 3911
Sequence
3850 bases(100 bases per row)
TATACAATCAAGGAGATTGTAGACGCCAATCGAGGACGAGATCAACATATTGAGGCAATGGAATGCGTGAAGGTGACTGCGACCGAAGAAAACAGCCACA
TGGTAGATGATCCGTCACGAAAACGGTCCAGCCATCAGCAAGACGCCATCTCGATTAAAGATAGTGGGTTGCAAGAACAGGCCAAACGACTGGTCGAGAA
CTACGAAGCGGTAAGGATTGACACACCTGCGGAAAGGGAAAAGACAGTGAGGTCTCCAGCGGTGATCGACGCGATTGAAACCATGAATGAGATCGATCGA
GTTATAAATCCACCAACTCCGACGGTATGCAAGTCGAGCGGAATCGAGGACAACGAGTGCGATAGAGCTGATTCAGACCATAAAAAGTCCATCCATGAGT
CAGCCGGGATTAAGAGCGCAGATTGTGAGTTCAAGAACGGGTCGATCGACAGGCGGAGGAAATGGGTAATACCAAGATCGACGAGGAGATGAAGAAAGAA
ACGGTATCGTCTGCAACGATATATTACCACGATGGTGGCGAGTTGTTCGCTGAGGATGTAGACCAGCATATAGAAGTTCTACCCGAAGTTATTACACCCG
CGCAAGAAATAACAATTGATGATATCCAAGTAGGCGATCGAGGCGTCCGAAGGACTGATGATCAAGGTAAGTTGCGACAAGTGATTTAGAGAAGTCGCTT
TTGGCTGATTGGAAAATGTAATGCCCAACCATCTGCGGCGCGTGGGGAATTTACGAAATAGATGCGGGTGGGGCCAACCCGGTCGCGCAAAGGGTCAGGC
CTGTAGCTTCCAATTTTTTGAGAGAAACACGCCAATCCGATTAAAGGGTTACTGCCGGCCAAGATCATCCGACCATCTACATCACCACGGGTGGCTCCTA
TAGTGGTGATCATCAAGGCAAACGGAGAAGACATAAGGCTGTGTATTGATTACAGTCGGGTGAACTAGCTGACTAGGTTGATGGTGTATTCGATGCCTCT
GATCAGTGAGCTATTGTAGGACATGGACAAAGCCATGTGGTGCTGTTCCCTGGACATGGCGAGTGGTTGTTGGATGGAAATGCCTTAAAGAGCAATAGCT
ATTTCCGCCTTTATCACACCATCAGGGTTGTTTGAGTGGTTACGGATGCCTTTCAAGTTAAAAAACGCTCCACAGATTTACGAACGGTTGATCGACAAAG
CTCTGTACGAATATCTAAAAATTGGTGCAATATCCGAATCGATCACGGCCGGGTCACCGAAGTTGATCGATTCCTTCACCGATGGTGAACCAGATACTGA
TCCGAAACCATCCGTGTTGCATCGAAGATCCTATATCGACGACATATTGATACCAGCTACGTCGTGGAAATTCCTGTGTGAACAAGTGGGAGGTTATTGA
AGGCGTGCGATAAGTGGAATTTGTGGATCAGTTTGGCCAAACGTTTCTGGGGACGTCGCAAGGCGGAATACCTAGGACATCAAATCTTGCTCGCAGGTTT
GGAAGCTAATCCGAAAAGATTTGGGATAATTGGTGAACATCCGGCTTCCTCGGACGCTGCGATCGATGCAGTCATTTTTGGGAAGTCTTAACTACTACAG
TCGAATTATTGAAGATTTCGCAATTTACGCATCAGTGTTGTACGAGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CTGAGAAGGGAGAAGATTAAATACTCGGCATGCTTGCGGCAAGTATAACACCTCGTGAAGAAGTAGATGAAGTGTTGATTGCTATCGCCCCAAGGAAGCA
GCCAAGACAGACGATAAGCATGCCACCACCCACAGTAGGTGTGAATGAAAATCTGCTGGTAGCCAGTTTCGATGGATCAGCCAGGGTGAAAAGTAACGGC
GGAGCATACAGCGCGATTATATAAAAACTGCCAGAGTGGACGATTGTGGCTGCTGCTTCCGAGTTTACCCCTGATCTGAACGTGAATGAAGCAGAATACC
GAGGGTTGCTCCTCAGCTTCGATTTTCTTGACGGTCATGCTAGGGGGCGAGTGACTATTTGCGGAGATTCAGATTTATGGTTCTGCCAAATACGAGGAGA
AATCAACGGTAAGGGGACCAGGACTGCAGTTGCTGAGACATAGAGCGATGGAGAAACTCCGATCGTGACCAGACCATGAATTCTTGCATATGAGGCGTGA
TTGAAATCAGAGTGCAAATCTGTTGGCGAGTCAAGCACTATGGAAAGAGAAAGGGACAGTTGTGATTTCGGATCAGGATCGTCAGGATCTGATCACTATT
AATTGGTTAGACGAATCACTATTACTAGAACGAGTCGATCATGCAGTCAAAGTGGCGGCCACCACTTGATCAGCTCTAAGAAGACGCTATCAACCCGGGA
TTTTACAGGAAGAGGTGGATCGATCTCATTAAGCAAGTACTAGACGAAGAAAATTGGATATCTACTCTAAAGATATATCTGGGTGGAGATGTGGCTAAAT
TAAAGGCAGCTGAAGCCAAAGTTTGCGCCCTGATCGCACCGGATTACGAAGTAGACCAAAGGGGCTGCTATTCTTCTGTCGGCCACCGAAGCTGAAGATC
GTACTGAACTGGCTCATTTGGTGGTTCCAGAATAGTTACATCGAGACTTCTTGCACCACTACCACACAAGTTTGGAGGGTAGTCACCAAGGAATCGGCCG
TACCTATCACAGATCAGGGCGAATTTCCATTGGCGTGGGTTGTACCGAAGTGTGCAGCGGCATGTGGGAGAGTGTGTAGATTGTGAAACGGGAAAAGGAC
GGCCGGGGATCGAAGTGAATCACCCGGTAATGTGCAATCAACGTACCCCTTTCAGATTATAGCTATGGATCACATCCCTTCATTGCCAAGATCCTTTAAA
AAGAAATACCGAGCTGTTGCTGTGGGTCGATTTGTTCTCGGGATATGTGA