Description :
From Genome Similarity Track
Location :
Scaffold_2851:61- 2725
Transcript NameFunction/comments
Phyta_totarag14880hypothetical protein

Sequence
2664 bases(100 bases per row)
ggatcccgctacaccatCATAGTGCGTGTGCCTGGATCTTTTGATGCCTCGGGATTTCACCGTGAatcccaagaagaagttcaaaTGAAGACTGAACAAG
GAAATCAAGCGTCGTCGGAGATcggatcgacgacgacgccgctgaATGAAGCAAGATCCGCAGGTCGACAGAGTACTGGGAGGAACTCTGTCGATAGAAA
TGAGGGAGATCTGGAAACAGATCTAGAAGAGAAACCTAAACCTCTTCCCCAGGTCTCTTCGGGGACCTCAGCGGATCTTGATATATATCGATGTCTGCAA
CGCAAAACCGGTAAAAGAAAACCGGAACCGTACGCGTTCATGACGGAAGAAGTGACCGCAAGCTCGCTAGTCCCAATGTCTAatacgaagaagaagaaaa
cgaagactACGCGGAAGCAAATGAAGGCACCTGAGTCGGAAGGCGAAGGTCAGAAGGAATCTCCATCTGCATGGACCGAGCAGGAGCTAGAGTTCGCGTT
TCACCACAAGGTGCGACGCAACTTCTTACTCCAAGATCCAGTGTTGAAAATCACGAAAGTACAGCAGATCGGAGATCTGAAGGGACCAGTGTCAGCTCCG
CCAGAAACGNGTGCCAGACTGGCTCTTCACATTATGCATCGGCTACATCAGAACCAGACTCCGATGGATCTATAAGGTTGCGATGCATGCCTCTCGGACC
GTCCGGAGAAGCACTACTGagatctcgatctcgtgggAAGTCCCCGGATCGGATGCTGCCGCGACAACAGAAGCCGCCGCAGAGGCAGTCAAACCAGATC
ACGAACGTAACTTCGCCGGACGGATCGACAGGCAGACTGGAATCGTACTTCCAAGCTGCTATTAGTCGATTCCTCAAAGAACAGCAGATCACGGCACCGA
CCCCGGGCCCGGCCACGACAAGGAACGTTGGAGCGTAAGATGTGGACATGGAGTCGGTCGGATCGCCCGATCGTCACCCCGCTCTCTGGGAGTACGACCT
CGACGATCTGGATGACCCACCCACACGTGCCGCAGTGGCCACAACGACGACTGGATCAGCTGGATCCGCGTTTATCCAACGTGTGCGGATCTCAGCAATC
TCGGATCTGCAGGAGTTCACTGGGAaagatcaagatgaagatcggGCAAGAGGGTGGATCAGCAAGGTTAAGTCCGCATTCTTGCGTGGTCAGGCCTCCG
ACGAAGAAAAGTGTTTGACATTCGGAGATCTGCTGACAGGACCTGCGCGGAACTGGTACCGTCAGTTGAGCCGAACAACGCGAAATAAGTGGAGCGATCT
ACTCCGCAGCTTCCAGACTCAATACTGCGGTCTCGGCGTCTCAGTCGCGAGACAATACTACCATGCACGCAAGAGATCGGACGAGACCCCGCTGGAATAC
CTCTACCGACTGAACGTAACGGGCTTGCGAGCAAGCTTGAAGGTCAAGGATGCTGGAGCGAAGGAACGCCGAGAACATGTCGACCATTTCATCGAGACAC
TTGGAGATCAAGACCTAGCCGACCAATTGACGTTGATGCGACTGGCAGATGCTGACGAGCTAGAGGAGGTCCTACGCACCCGCGACAGGGCCAAAAGTCG
ACTGAAGCAATCAGCCTTTGGATCCAACAAATACCGCCGGCTCCAGCCGCACCAACAAAGCGGGCGGTCTAAGTAATCCAAACCCAAGACTCCGATTCAG
GATCTGACTCTGGATCTGACAGATCTGAGTCGGAGGGAGACTATCTTCCTGACGATAGGAGATAACCCGCCACCGGAGCCGACGGATTCAACCCGAAGTG
GTACAGATCTAGCTCCACAAGACCGAAGATCATCAGACCGATCACCACGAGAACCCAGGTCGCAGATCCAGCAGGACGGGTCAAACCGTAACCGTCGTTC
GCATTGTGGATCTCGTAAACACACGGATCtcggctgctggagacgttTGATCTGCCAAAAGTGCGGGAAGAAGGGTCACCCGTCGGATCACTGCCTTTTC
GTGTGTCGCGGATGTGGAGAACTGCATGATATAGGAAAATGCCCGATGGAGGAGTTCTACAATCAACTCCGTCAGTGGTACGATCCGACCAAACATGCTG
GCATGCTTCCGGCCATGGCTGAGAAGATGTTAAATTAGGACGCTCGTCAGGTTGGAATCTGATACGAGCCGAGCGTTCTGAGATTTGCATTTATGCATTT
GTGGGGAAGAAGTCGGTAGATCAAGTCAACGGACAGCAGCTAGATCTACGCGGTAATACATGTGATCTACATGAGAAACGCACAGTCACAGTTGCAAGTC
TTCATCGTGTAGATGAATATAGCAGATCCGACGTGATGATGTCtctggatctcctcgcgGGAGAGTCGCGAGGTTACTTGAAGCATCATGCGCCGGGTAA
GTGGTTCAGACAAGCGAAAATAACGGGGAAGATCAACAATGAAAAGGCGATCTTACTCTTAGACATCAGTGCCAAGGTGTCCACATTGGACACCGCCTTT
GCTCGTAAGGTTGGGTGCTATGTCGACACGAGTCAGAGCCAAGATTGTGTGGGGATTCGAGAAAGTACATATACGACGAATGGAAAGACCCGAATCAAGA
CCactgtggtattgcagaacacacaattcgtcagatgtggatcctttagcaacaaacacaacaa