Description :
From Genome Similarity Track
Location :
Scaffold_311:61- 2382
Sequence
2321 bases(100 bases per row)
GGTACAGCGACCACGTGTACCATTCTGCTGAATCTATCAACGAACACAAGAATTCCTGTATTCTTGTGTGGGTCTGCGAGGAATCCAAAGACAAAGTCTA
TTGAGACTGATTCCCAGCATTCTGCCGGAAAGGGCAAGGGTTGCAGCGGCGCACGAAGTGAAGGACCAGACTTCACTCGTTGACATATTTCTCATGCGCG
GACGTACTTTCGCACGAACTGATACTGGCGGGGCCAGTAAAAGTCGCGACTAACTGTGAGATATGTCTTCTCTCGACCACGATGTCCACCAGTAGGTGCA
TCGTGGTACTCATACATGATGCGCAGTCGCAGGTTATCATGGTCTCGGTACGACGACACGAGGCGTGTAGCCGGCAACGGCTGTATACTTCAGTAAGCCA
TTGTGGACTGTATATCAATCCGTGGAGGATCGATATACTGGGGGCAACCTTTTAAGGGATTGACGGGATGGTTGCGAGAGATGATCCATCAAACGCACCA
CCGGATCGTACGCCTTGGGTATGTCTTCGAATAAGGTTGACGACGGGACACTCGACGTCAACACCGCGACAGTGGCCGGACCAGTGTCGGGTTGCGCAAC
CGATCCGAAATCGGGCCGGCGCGACAGAGCATCAGTGACGACATTCAGTCGTCCCGGATTATATTCCACGGAGAAGTTAGACCGCGAAGAACGGCATCCA
CCTCGCCATTCGTTGCGAGAGGTGTGGACTGTTAACGGCCGTGCGTAAGGACGCATGGTCCGTGTATACGATGAAGGGTCTATCACCTAGTAGGTAGACC
CTGACTTTTGCCAAAGGATACTTCATGGCAAGGGTTCCTTGTCATAGACTGAGTAGTTACGTTCAGGTGGTTGCAGATGACGTGACTGATAGCAGACGAC
ACGCTCAGCACCGTCTGTGTCGTACTACATTAGTGCATATCCGATGGCAAAATCACTTGCATCGCAGTCTGTCTTGGTCTGCAATCGCCAAAACTGGCGA
GCGTATCAATCTTTGCTTGATACCTTCGAATGAGCGCTCGCAATCAGCACTTCATGCCCACTTCTCGTTCTTTTTCAATAAACGAGAGAGATGAATAGTC
ATCTCGGCGTAATTGTGCGAGTATTTGTGCAAGTACGCCGCTAGGCCAAGGAACTTTCGAAGTCCTTTTATGTCGGTAGACACCGGCCAGTCAGTGATTG
CCTTGATCTTTTTCGGATCTGGCCGGACGCCGTGCTTACCCACGATGCATCCAAGATGTGGTATTTCGCTTGCAGCAAATATACACTTCTTGAGATTGGC
ATACAACTTATGCTCACGCATCAGTGTAAGAACTTTCCTGACGTGGAGTCGGTGGACTTCCAAATCCGTCTGTCCATCCATAGCCCGGCTATGGACGAAC
ACGTCATCGAAATAGCTGGGTGCGAATTCTCGCACAGATCTAAACAGATTCGTAACACATCTGTTGAACGTAGCAGGGACATTACTTAATCCCTGTGGCA
TAACTATCCACTCCCAGAGCATACCGCTCGGGGTGCTTACTGCTGTGTACGGAATGTCCTTTTCATGCATAAGGATCTGATAGAACCCATCCATCAGATC
CATCGATGAAAAGTTGGTACTCCTTGACATACCATCTATAATGACATCCTTTCTTGGTATCGGCGTTTGAGCCGGTACAGTGGCAGCATTCAACTTGTTG
AAGGCATGTACTATCCGCCACCCTCCTGTGGCTTTTCGGACACAGAAGGTCGGAGAGCTTTGAGGGGAAGTTGTTTCCCTCACATGATCCGCTGCCAAGC
GATCAGCAAAGAATTTGTCATACGCTAGTACTTGTTCACGAGGCAATGGCCATTGCTTCATGACACAGTACTTTGACCCTGTTTTCAGGTCTATCTCGTG
ACGAGTACCCTTATCCTTGGGTAGCTCGTACGGCACTGTTTCTGGAAACACATCCCTGAATTCCATCAAGTCATCGTAGAGAGGATTTTTCTTAAGCAAT
TCCCACGATTGGGATGTATATCGCTCAATCCGAGTCTTCCCATCAAGGACACTCTCGTCCATTGATGAGCTGCTGAGAACCCTTTCGTTCTCAGCGAATA
CAATTGCCGACCGAATATCGGTTACGTACTCGTCTTCCGCGACGAGTACGCAAATCTGCTTGACTTTGCCACTACGCAGATCACGCAAGAAACCTTTCTG
TTCGAGCGTGGGCAATTGAATGATCTCCGTAGTTGTCTTCGGAGGCAGGATCAGATCAAGTTGGTGTGTTTCTATGCTTGATCCGTCATTGACTAGGACA
TTTAATGGCTCTGTTGTCTCC