Description :
From Genome Similarity Track
Location :
Scaffold_2158:61- 2245
Transcript NameFunction/comments
Phypl_g14753conserved hypothetical protein

Sequence
2184 bases(100 bases per row)
tacagcactTTTTGCGGCTTAGAAACATCGTACTTAACGACTTACTAAAATCTTTGAAAATGTATACCCCTAAGAAACAGATTGGTATTGTACTGAAAAG
CCTCGGTGTTACCGTGAATTCTGAGATAGCATGCGAATTTTGATATTTATAAAGTGTTTCACTTGAACAAAGTATATGTTTtcttggtgtgcaccacata
cCAGACCAAACGAATTAATCCTTGTTGAAACTCGTTGCCGAAAGATGTTTTTAGCCAACCAATCAAGTGGCTCGAAAGTGGACCCACTTTCTCCCCCGCC
AAAATCAGAGCGACACCGTCCAAGTGCAGCAACTGACACCATGGCTGACGGCTACGACCCCCAGAAGTCTCGCGTGGCGGAGGACACGCTGGCCGACTTC
CTGCGCGCGCCTCTCACCGGCGACCTAACGGAGGTGCCCGGCATCGGCAAGGCGGCGGTGACGAAGCTCggcgaggcggaggacggAGAGGACGCCGTGA
CGAACACGTTCCAGCTCATCGGCAAGTTTCTCATGCTCAAGGTGCGTCGGGGTGGTGTCTGGTGGGCGTGGAAAAAGGGGGGCGGGGTGCTGATGCTGTT
TTGTGCATTGTATGCAGGATAACTcggacgacaacgacgacggtgTGATCGACTGCGCGACCCACTGCGACGCCTTCTGGTTCTGGCTTAAGTCCAAGGG
CATCACGGCCTACAGAAGGTGGGAAACCTAGTACACTGTAGAGGCTGAACCTGTCAAGGCAGAGACGTGGATGCATCTTGTAGCTTCCGTGTCGTCCTGG
GGGCTGGGGACGGACTGACTGATGCCGTATTATtattgttgctgcttgtaGTGGTATTGTGATGGCCATTGCTGAGAAGGTGAACACGATGCTGCCCGGT
ATTTATGACGCGGCAGAGTTCCAATAGAGGAGCATAACAGAAGCAGAGATGGTGAACATGCACTCGTCTCGACGGTCGTGTGGCGTACAGCTCTCTGCGT
GAACTTCGAACAGGAAAGAGGTCCAGCATTGGTAACAACATCCTCTGCATCGAGCACTCAAGAAAAGAATGAATGGAGGAAAGTGATTGATCTGTCTCGA
GTTGGTGTATTTCGTTGGTATCTTTGCGCTGTATCCCCTGATTCAATTTCCGCGCTGACGTAGCGTGCCGAGGGGCGGCTGAGGGAGTGTGCGCACTTGA
CGTTGCGGCAGGAGAAGGAAGGGATGCTGAGCAACCAGCGACTGGGCTCTCGTCTGCCATTGAAGCAACTATTACTTGAAATATgtggcgccagcagcag
tattCTATCGCTATTCAGCAGCAAAAGCCCACTGATAGTCAACGAGTCCCAGTAACGCTTATCACGGTTTTCTGGCGGCTTTCAAGCGCCTGCCAAACCG
GAACCGTGGTTTTTATCAGCGCCCGATGCAAGGGCCGATTCAACATCAGACATGCTTAGCATGTCGTGTCTTTGCCGTTTTGAATTGGCTCCGCTACATG
TTGGAGGTGGTTTCGTATGCGTCCAAGAACAGatttgtacatgtactcgttTGGGTCGATTTCGAGTCAAACGGCTTCGTTGGCTGCGAAACATCCACCG
TCGCGAGTTCGCTGTCTAGGCCAGCTACCGTGTCAGTTTGAGCGACTCCTTGCAGGTGCTTGCCAGCATGGAGAcagtcgacggcgccgctTCGTGTCGG
TCTCCGTTCCGCTGAAGAACCTCCACCATCGGGAAGGTTGTCATCTAACCTGGAACGTGATGAACCTATCGACGAGCTTTGTCGGTGCCGTATCGGCACT
TGCAGTGAAATGATTCAGCGTCACCTGGAGGGCTCTCAAGCCTTGGTCACAACATCGATGAATTCCACTTTCGCACTGGGCCCCGGCCTGTAGACGACCC
TGAGCGCTGGGCACTCCCAACCGCCGATGCTAAGGCCGTTTTGAGTGCGTTCATGAATGCCGTCGGCTCCACAGTGTGGATGGCTGGCAGAGAGCTGGAG
AATTATGTAAGTCGTTCGAGTGGGCGAAGCATGACCATTCTCGGGCAGCTGATGTGCaggcgatggccacgaaAGCAGTCAATGGAATCCCTCGTACCGG
ACTTCCCGCCGGCCTACGAGGAGCCGTTTGTGGTGCCGCTCGACAAGTAAGTGAGGCTGTTGCTGTCGATCGAAGTTGGTATGC