Description :
From Genome Similarity Track
Location :
Scaffold_1982:61- 1816
Sequence
1755 bases(100 bases per row)
GGCGATGCGCATAGCTTAGCCCCTGAGAGAGAACAGCTCACTCGAATGGGAGAAGCCAGCCGTGGAGGGCTGCTGGTCATTCGCGCGAACGTCAAGGGGT
TCGCAGAGCCAATATGGGTACTCATCGACTCAGGCGCGTCGAGTAGTTACACTCGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGGAGAGAAATCGCGCGATGTTCGATGACGCGCTGAGTGCGAGCAAGCACTCGGGCCGCACTGTGGTCCGCCTGGCAACAGGCAAGGTGATCGAGTC
ACCGAAGATCCATGTGGATCTTCAAGTCCGCTTCGAGGACTTTGATTGTGTCGAGCGCTTTACAGTGCTCGACCTGGATGAGAAGTATGATCTCATCCTG
GGCATGCCATGGCTCGAGAACAAGAGCCATGTATCGACTGGAGGTCCAAGTCGATCGGAGCCAGTAAGTCCCAGACCTCTGATCGGATGTCGGTGAGCAA
GGTGCCCACCTCATCCAGTTGGCGTCGCCATGAATGGCGCGAACGCCGCGTCGATGACGACGAATACATGGTCGGGGTGTCAGAGCTCATTGACATCTCC
GAGGTGGCGCCGTCCACCGAGCGTCCCAACGACATCGCTCTGCCTAAGAGGCATGGAGCCAAACGGGTGGGGTGCAAGCCCACCTGCAATGACGAGTCGT
TGGTCGGCACACGCTACGATGGCGTCGCTCCGTCCACGGGACGTGGGGCCGGGCGAGCGGGACTGAAGCCCGCCGCCCCGATGAAAAGGAACAATTGCGA
GCATCGAGATGATGCTGCTCCGCCAGAGAGGCGTGGAGCTGGACAGCACGACACGAGGTCGGCCACCTCCACTGAGGCAGGAGGAGACACGAGACACCAC
GACGGCGGAGCTCCGCTCGAGCACGAGCGTTGGAGCGCACGGCGGTCCGAGACGGCCGCCGCGCCGAAGCGGGTGCACTGGGCACCGCTTCCAAAAATCG
ACGAGCGACGGTTCGAGGGTGAACCGTCGGGTCCGAGCGTTGGGACCGGTTCGGGTAACGCGGTCCCGAACGAATTTGAGAGGGTTCCTCCAACAGAGGA
CCGGTTCGAGTCCGGTTCGGAGATCGGGGACCAGGCGGCCACGCGGCCAACCGCCCGTTCAGGGCGCCAGACGAGCGCTACGGACACCGAGCGCCTGGAA
GAGGCACGGGTGTGGCGCGGGCCACACCCGNNNNNNNNNNNNNNNNNNNNNGCGAGGCCATGCATACGGCCGCCCCTGCATCGACAGTGATGACACAGTG
CCGCCGGATGGCGGGCAGATGGCAGCGCCTGACAGTGGCGTCACCACGACTCAAAGCTCGGAGAGCAAGGAGCCGCCCGACAGGGTGTTAGTTAATGCCG
GCGCATGCAGTGCGCCAGCGCGTCACGGACGCGTCCGAGCCGAGGGCCGGACTACACCCTCATCGACGGTATGACTGGGGTGGTCGTGGCGCCAGCGGTG
CCGCTGGAGCCGCTTCCGGAGCTGAACGCTCTGACGAAGCTGGGCGAAATGTCCACGCAGGACTTCATGCACGCTCTTGAAGGCGGCGAGGTCGCTGAGG
TGGTCGTGATCCGACCGGATGTGGAGGAACTCAACACATCCCCCGTCATGGACGAATCTGTTCTTGAACAGATCCGCGGCCGGATTAGCCTCCGGCGAGC
CTCAAGGGCCCGAGGGATCCGTTGCACCCTCTGTTGAAGGAGTACTCGGACGTGG