Description :
From Genome Similarity Track
Location :
Scaffold_115:61- 1461
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19344hypothetical protein

Sequence
1400 bases(100 bases per row)
AGAACAACATGGTTAGACTCGCAGGGGTATACTTGTGTTCAGCAAGAATTAAGACCAGGTTCCGGTAGGGTCTCAGACAACAAAAAAACGCATTTCTTTT
CAAAGCGCACATTAACATTGATCACAACTTGTGATCAATGTCAGCGTGCGCTTTATGTTAAGTTTCACATATGCATGGCTGGTGTCATTCTTTTTTAGTG
ATCATGAATCATTATAAAAGGGACATTTTGTACATGTAAAGCCGCCTGGTGTAATATAGCCAGTTTGCACTTGTTCTCAAAGCGCACAGTGATATTGATC
ACAAGTTGTGATCGGTGTTAGCGTGCGCTTGCGTTAAATTTCACACCTTCGTGGGGTGTCGTTTCTGGGGGCAAATCGTTATTTGCAGACAATATCATAA
CATAAAAAAGTATTCGGAGCTGATTGCTTTCCGAATTCTCAGCTTCGAACTGTGAATATGCCTCTTGTGCCTAACGATAGGCGATATAATGTAATCTGGT
TGCATGTGACCTTTGTGTTTTTTCGACAGTTTTCTCTGCCTAAAAAATTGTCCATAGGCCCCGTACAGCTCACAGTTCTGTCGGTGACTAGGTGGCCAGG
TCCGGCTACTTGCCATCAGTGAATGCGTGCCAGTAAGTCGATACGTCACATAGAAATTTTCTAGTTCAACGGAACACGATGCTGGGGTGTATTGGTGATG
ACCAATGGTGGTTCCATAGCTGTGGAAACTCTGTGAGCGGGTGCTCCCAGAACAGGGGTTACATTCGTTAAAATGACGGTATTGAATTTGAGTATGAATT
AGAGTGCCGACCTAAACACCCCTCGAGGATAGATGTTCTAGAACAAACGAATTAATCCACAAAAGAAGTTTGATGCTTTTTAGTGAACAAATCAAGAGCG
ACGGATCCCGTCAAATCTTCCTTCATTGTACCGTCGCTTTGAGAGCTGAGCCGAGCTTCAGAAGGCCTAAACATGTTTTGTCATTCCTCAATTTTCGCTG
TAGACGACAATCCAGCTACCACCCAAACTATTGACCAAACATGCTGTCCAAGTTTGTCTTGCCCGTGTTAGCGCTGTCGGCGCTGGTCACGCACAGTGCT
GCTGTCATGGATGAAGGTGTTCACCTAGGCGAGGCTTTCGGCGGTCCCCACGGCACCAAGTACTCGGACGTGGACCTAATTGGTCCTGGACAAACCGTGA
AGGCCATCACGATCCGCGCTGGCGAACGCATCAACGGTGTCGGCATCGATTTCACCGATGCCACAAAGTTGATGACCACCCTATACCATGGCGGGCCTAA
GGGCAAACCACGTGTGCTCACCTTAGGTGACGGTGAATACATTACGGCGATGGAGGCACATTGGGGCGAGAAGGGCGATCACACACGTATCAAGTACATA