Description :
From Genome Similarity Track
Location :
Scaffold_3829:61- 1298
Transcript NameFunction/comments
Phypl_g16051hypothetical protein PHYSODRAFT_329272

Sequence
1237 bases(100 bases per row)
GCTTCTGGGTGCCGCAGAGGCAGACGCGACCTCACTCTTCTTTGCTTTTCTTTCTCGCAACAGACAAGTCACCTGCTCGCCAATTGGCCCAATGTCTCGG
GCTGACTGTATATTTGTATGTATGTATGTACGTTTGTGCGATATGCGGCCGCTTCTGCTATTTGAGCGTGGTGTGCTAGCTTGCGTCGACGTTAACATTG
CTGTTCCGCAAGGAGGTTAAGCTTTGTGTTCGATGCTGTATTCAAATTACATGTTCGCGTACTCTGTGACGAGGTTAACTTTGCTGTTCCATTCGGAGGT
TAAGCTTAGTGCTCACTACGGGGTTACCCAGGCACTACTCGCCTACTAAAGCTTGTAATATACCTGCCATTTGCTTCTTACTCGATTGCTGCTTATTGTT
CCGTGTCGTTCAGCGAGTTGTCCTCCACAGCCTCGTCTTCGAAGAAGGTCTTGCGGACAAGCAGCcggcgctcttcctcgaaggCAGCGACAAGCTTCTC
GTTCAAGTGAGCCTTTGGCTCCCAAGTGGGCTGTCAGTCGACCAGGTACTACCTAACCCTCTTCTCACGCTTCCAgttgagcagcttgtggaCGTAGTGC
ACCAGTTCGTCCTTGCGGTCATCGTCAGCGCTCTGCTCcgaggcgtcgtcgtccgcatAAGCAGAAGGTGCGAGCCACTCACGTACGTCTTCAAGGCCAA
CcctgcgcttcttccgctcAGCGAGCGAGGCAGTGATGACGTCGATCgcttcaagcagaaggcTTGGGGGGACGACCGTCGTGTTCATGGTAAGCCTCAG
GTGACGGATGGCCTCATTACTCACGTGAATCTTATGCTTCTTGCTAGCAGCGATGAACAGGGTCTTGAACTCCTTcgcggagctgacggcgTTCTTGGTA
GGCTTTGGCGCAATCGTGATGGCAGAGGAGTGCGTGGTGGAGTGTCGAAAACAAAGTGGCGAGCGGCAGAACAAGCATCAAGACAAGTACAGATCGAAAT
GATTGGCGCGAAGTCACGGAGGTAAATCATGGGTAATTACGCAGCGGATATTAACCCAAGGATGTTTGTAGAATGCACGGGTGCAGGATCACCAATGCGA
CCGGcggcttgaagctgcttgtaGTGTTGGATGCGAGAGTTGATATGGCCGGCTTTGTGAAGCTTGCGCATGGACTTAAGGACGTTTTGAGACCCGCGAG
CTGTGATCTTGTGCTCGCCAAGAAACAACAGGAGTTG