Description :
From Genome Similarity Track
Location :
Scaffold_349:60990- 62145
Transcript NameFunction/comments
Aphin_H310_04774Hypothetical protein
Aphin_H310_04775PREDICTED: RUN and FYVE domain-containing protein 1

Sequence
1155 bases(100 bases per row)
TCACCGAGTGTGTTCGCGATGACCTGACGATCGTTGTAGGCCGATACAAAGTACTGGCTTGGCATCGACTACAATTCACTGCACACAAACGATCCTGCCC
GAGTTTACCTCCGCTTGGTGCGTTCCATGCCCCTCGTCATCGTTTTTCCTTGACTGCGACCGGTGTGGTCGCCGCAGATTGCCGAGCAAGGCATCGCGTC
GTCGTTTTCGACACGCACATCGGTGTATGACGTGCATTTCATGATCGAAGAGTTCAAATCCGTACGTCGGTCATGACGGTGACTCGATGTAACACAATTG
GATGGATAGAACATGATTGACTTTTCCACGCTCCGTCTCGAAGCGGTCGTGGCACAGGGCGCGACGGCGGTCGTGTTGCGGGGCAGCATGCACCAAAACA
GCAAACTCATGCACACGCCGGTGGCCATTAAAATGTACACGTCGCTGTTTGTCACGGAGGAGGACGTGCATCGGTTTTCAAAAGAAACGTCGTTCAATGT
CCAGCTCTCCCATCCCAACATTGTCCGATTTCATGGGTAAGTGACGTCGCGCGGGGATGGCGCCGTTTGACGGGATCTCCGTGTAGCCTGTGTGTGGTCC
CGCCCGCAATCTGCTTGATCTTTGAGTTCTGCGAATTGGGGTCCCTCGAAGTCGCACTCGACACGGACTACGGTCGGGCGCTCGATCTCGCGACGCGACT
CAAGATGTGCCTCGATGCATGCCTCGCCGTGGCATATCTACATAGTTTTGACCCACCTCTCTTGCATCGGTACGTTCCAGATCATCTCGAGAGGCGTCAA
CATGTCGGTTGTAGCGACATCAAGACGGCCAACCTCCTCCTCGCGACGAACGGTCTCTTAAAACTGAGTGACTTTGGCGAGTCCAACTTGCTCGGCCCCA
AAAGCGACGGCACCATGACAATTGTCGGGTCGGTCGATTTCATGGTAAGCATCTTCGACGACGAGATGGAAACGCGCTCGACCGTAGGCGCCCGAAATGA
TCTTGGGCGGGAAATCCAAGTCGGCCGTGTACGGCACCCCCGCCGACGTGTACAGTCTTACGGTCACATTGTGGCACATCCTCGTGCCAGGTATTGCGCC
GTGGTCGGGGCGGTCGCATTTCGATGTGTACACGGAAATCATTCAAGGCCAACGG