Description :
From Genome Similarity Track
Location :
Scaffold_19:60965- 66528
Transcript NameFunction/comments
Phyag_g562hypothetical protein PHYSODRAFT_509593
Phyag_g563hypothetical protein PHYSODRAFT_286379
Phyag_g564conserved hypothetical protein
Phyag_g565conserved hypothetical protein

Sequence
5563 bases(100 bases per row)
TTCtcgttgaagcgcttcaacatAATCGTCAAGCGAGCAGGATGCGGCCGGCGCCACCAGCTCGAGCACGACGTGCAGTTCCTCTCCAACAAAGCACTAT
CGATGCCCCTACTGCAGTGCAGGCATTATATGTCTCGATCCCGCTTAAGCCGCAGCAAACACCGGCTGCGCTGCCTCCTCGATTGCCCCAAGCAGTCAAG
GACGAGTTTGCCATCCGCTACTTACAACAGATCGGAGCAAACTCCACGCCAGAGAACATCGCGATGGTATTGCAGCATTTACCGCTAGAGAAATGTGCCG
TCGCAGCTGCCTGGAAATCTCGGGGCTCGTTGGCTGATGTGCTGACCGTAGACTTGAACCCCAAGGCGCTTTCCCAGTCAGGCGAAGCTCAAGTCAGAGT
AGAAGGGCGAGGCGGTGCAACGGTGACCGATACAGATACTGCTCCAATGACAACACTGCTGTCACCGAGACGGCAGCTTCGCGGTCAGCAAACGCGTCAT
GTTTTCCAGATTGGCCCCGTGTGCTTCACTTTCGACGATATGAAGCGCAAGTTCTTGCTTCCTTTCAAGCTTGCCACGCCACCACCTGAACTCGATGTCT
TACAGCTCTACGGAACACATCTAGATACTGACACTGACTTTGCAGATGTGTATTCCCCCAATCAAGTGGAACAACTTGGCACTGCACCTGACTCACCGAT
CGCTCTAGCGAGATGGGAGGCACAACGACGACAGATATCTGTAGACGAACGCTGCGTACCGCCGAACACCAGTGCACAAATAATGGCTGAATTGCACGAT
GAGTTCTACCTAACGTTGCCTCTGGCCTCGTTAGGGATCCccgaaggcgacgaagacacACGGACGACACTATACGAGGCGTTGGTTAGTCCTACGATGA
TAGAACTCGCCCAGAGCACGATGCGGTATCTCTTCATCACGGTCATTCACACTCCAGccaaagacagcagcagtgacgagAAAAACACTCTGTTTGTCAC
CATTGCGCAACGGTTCGCCGTTCTTCGAGCCAAGATTGAGCGCATGCAACGGTTAACTCCTCGACCGCAGCTCGCAATGCTGGTGCCACTTTTGTTGCTC
GCGCTGCGCGTAGATGTCGAGACACTTGTCCGTCTGCAGTATCCGGTGAGTTTTTCTTGTGCTTCAAAagagatgaagcagcagctacatgTGATCGACG
ATCGGATCTCGCAGCTATTAGATCCGGATGCCAATTGGACTCGtcttgcagtgctggagacAACGCACGAGGCCGGTCAAGCACGAGCATCCTCCACGTT
TCAACGtgctcgacgccatcgtcggcTTCGAGATCAATTCTTCCAGACCAGTGCAGTACTGCAGGGTCTCTTCCCTGACCCTTCATCAGGCAAAGCTCGC
CGCGTCATGACTCTACGTGGAGGCGCGGGGATCGGCCATTACCCAGAGCTCTCGAACGATCCTCCTTCCTCtacatcttcgtcatctttAGCTGACCATG
AGGaacgtcgtcctccagccaACGTTTCAGTCGCCTCCAAGCTCTCTCTTCTACGAAGTCTCAGACGCTTACAACCAACCTAAAGGCAACACACACAGCA
CACTAAACGATAGCAAATGGAGCGTCATATTCTTTCCCAAAGGGAAGACTGGTACACAACCAGCTTAAGCTCTGATCCGACCGACCGACCACAGTAGCCG
ATGCTTTTTAATTGGCGAGCTTCCCCCAGAGCATCTCAACATCGCCGCGCGAATTGGCAACGAGGGTGCGGCCATCCATGGTGATGACCTCACCCTTCGA
GTCCACGAAGACCAGCATGGGGATTCCCGTGACGCCGAACTTGGTGCTGATGGCCTGGTTGGCCGCGCGCTCCTCGAAGGGCATGGCCAGGAACGGCATT
TCGCCGAAGTACTCGCTGTACTGCGACGGGTCACGGTCCGACGAGATGAATACAAGCTCGAACTCCGGGTGCTCCTCGATCATGTCTTCGTACATGGCGC
TCAGGAAGGGCGTGAACTGGCGGCACGGCGGGCACCAGTGCGCGCTGAAGTAGAAGcccaccaccttcttgcccgCCAGCTTGTAGTCCGTGTCCTGCAG
ACCGTCCTTCGTCAGGATCTTGGCGCCGAGCTGCTCCGACCACTTCATGGCTGACGTTATATAAGAGTTCGCTGTGGGGGTTCTACCTTGGCTGCTGGAT
AGAGGATGAAGTGGGGATCCTGTTTGCTAAGCAGGCGCCGTACCGTGAGGGACACAATAGTGCGAGAGAAATTTTGCCACGTGGGTGTTTCCGTAATTAA
AAAAAGTACCGTGAACAATGAAAAAATACCAGTGCATTCCGTCATACTAGTTGGGTATGTCGCTTTCGTCTACGTAGAGTGCTACAGGAACAACAACTCC
AAACGACACGCAGCCCATTGATCTGGTATGACGCACGCACGTCTGTGGGGCTCTGTGTCCTGCATCTATTCCTCCTTTGTAGCCGCCTCCTGTTCcaact
gcttcttggcgttctcacgcgccagcttcttggtcaagTGGCGGTTCAGCGGCTTCGTGGACGGGTCGAACTcgcgcagcaccaccgtCAGGTGCGTGTG
CGGGTGGTGCATCACACCCGAACGTCCTGCaattaaaaaaaaacattTAGTTCAATCAACCAGAGGACTACAACAATTGCAGTCGACGCACCTCGGCCCA
TGATCCGCAGACGCTTGAGGTAGACGCCCTTGTTCACGAAGCACTCGGCCACCATGAGGTTCTCCGGCTCAATCTGGTACTTGATGTCGGCCAGGTTAAT
GGCATTCTGCACCGTCTTCTGGAAGATCTcggccttgcgcttgggcGAGAACTTCATCTGCAGGATGGCCTCGTTGGCCGAAAGTCcgcggatctgctgc
gccAGGTACGTGAGTTTGCGGGGGCTGGCGCGGATTGAGCGCTTCACGGTCTTAACGGTGCGCATCTCGGCGGGAGACGTGGAGCTCAGGAACGCGGCTG
TGTCAGCGTCCGAAGCAGCGGCGGATTCTCCCTCCACAGCGGTCGTGGACAGCGTTGCCCGAGCCACGCGTCCCATGAAGGCGCTACCGGCGGCCGGGCG
GAGCGTCAGCGCGCCCATCGACGAGCGCAACGAGGCCAGCATCTTATCCGGACGTGTGAGTTGCTGGGGTTATTGAGCTCTTTGCTGCCACACATCGATT
AGGAACTGTGGAAACGAATATTTTGTACTGAATCGCTTTAGAAGGggtgtggtgctggatggCTACACACATGTTGAAGCAAAGTCTCTTTTTTTTctgt
tgccgctgcttgcTGTGTGTGTGCAGCTTATTGAAATCGGAGACCGAAGCTCTACAGAGGCTTTCTAACTAATTGGTAGGGACGTGACTTGATATACGGC
TTGAGTTGCGTCCTGCCTGTTCGGTTCCGTTGACTCTTGACTTGCCTTTTGCTTTGTTTGCTTCCCACGTCACCACATGCAAATACGAGGCCTCTCTTAC
GCAaacggcgacgtggtgcgcgtcttcttgtcggagATCCAGATACGCAGCTTCTCTAGGTTTTCAGGAGGCTCGTCCgtgccgtcttcgtcgccactgc
cATACGCGCCGGCGCTCATGCGATCGACACTTGCACGACTAGCTGCGTTAATATTGTCCGCGTTATCCGGCAGCCACTCAATGTTCACCTCGATGTCGGT
TCGGTTAGACACCAGTGGCATGAGGTATGACACGAATCGCTGTCGAGAGGCGGGTGGCAGTGATGGAATCTCGATGCCTCGTACGGTGATCTTGGCCGCA
GAAGTGCCCACTACAATATTGGCAATCCACTCACCCAGGTACTCAAACTTGTCTGGTCTCCCCTTGCAGATATCGCGGCGTAGTGACAACAGGAATTCTT
GTGTGAACTGCTTGCACTTCTTCTGTAGCTTGTACTGCACGATGGCTTCGCTGAGCGCCTGCATCTGTTCCGAGTTTTCCATGCCGTGCGTACCCAAGTC
ATAGCAGTCACTGCACAGGTTGTAATTTGAGCACACACTGCATGTCCAGAGTGCACCCACGATCGGGTCCATGCCGCAGCCATCGCAGAACGAATTCTGG
TGCACGATCGttttcttgcgcttccaCTTGGAGCCAATGATAGACGCTCCTTGGCTCATAGCTGCTCCCAAGCGCCCCATCAACGGCTTCGTAGGCGAGT
GTTTCTTGTCAGGGAGACTCTTAGACTGCGCACCATCCTTGTCGTGCACGTCACGTTGGAACACGAGTGTCCGCGGGACCGTAGACGTCTGAATGATCTC
AAACACCTGCTCCTTTGTCATGTGCGCCTCGATGTGCTGTCCATTCACGCTGATCAGGTAGTCGCCCACTACCACACCTCCACGCTGCGCAGGgctgtcc
ttctccacactCCAAACTTCGACcaacagctcgttctccagcgacaCGACAACGTTCGTATTGAAGCCCAACACAGGCTCAGTAAATGTCAGGGTGTATG
TGTTGATAGGGTGCTCCACGTAGTCGACTTCGGATTGCGAACGCAATCCACCCTTAGAATCTGGAGCATGAATCGCGCTTGCGCTCGACGAATTCCGCCC
CGAAGATTCCCCACTGCTTGTCACGCTGCCTGAGTttgctgcaacaactggTGCCTCACTGATAAAACGAGGCGGCTTGTCATGGAGCGCTACACGACGC
AAGCTGTGCAACGCACGAACAGATGACGGGTCGGAGGCCACACTTGGGCCCAAAAAGCGATGCGAAGCTAAATCATCTGAACCCTCGCCAAAATCCGCAG
CACCGCCGTAACCCAACGGCGTACCGAGGTCGGCaccttcgtcatcatcatcacctgcagctccttcttcctgttcATCACTGTCACTTGCCTCATCATC
AATATCATGATGCACCAGATTCAAAGGCGCCGGTCGTTTCGGCGATGGGAtcaccagctccacgccaTGCTCATGCTCCTgcacgtcctcgtcctgcacC
TTCAGCTCCACTTCATGAGCCTgaatctccatctcgtcaaTAGTGGCAACCTCCGTAGGGGTTGCTGGTGACTGCAACTGCATCGTCGTCCcctcctcct
gttcctgctcttcaGGTGTAACTGCCTCCTCAAAGGTCTGCTCTGGAGGCTGCTCTACAGGCGTCGTCggctcctcctgctcttccacgGGTATCGACGG
CTCTGCGACGTGCTCCACTGGCGTCGTCGGGGCCTGagtttcctgctgctgcttgatcgtctcctcgtcgtcgtcgtcgctgtccgtTCGCGCCTTATCT
GACTCGGCGCCGTCCTCGTGAACTTTGTGCAGTGCCGCCTCGGGACTtttctccgtctccacctcgcccACGTCGCTCTCTGTGGGGGTAGCCGGGCTCA
TGGCGGCGGTCGTGGGTTCTCCAATGGCACGAGGTGACTGCACGTGCGTCTTTGCGGGTGGCACGCTCTCCGCTGCAGCCGGCGCCTCCATCTCTCGATC
TAGCCTGCCTGTTGCGAGCGTAACGTACTGTGCGTGGGGTTCAGTATGTCGTCCCTTTGCTGA