Description :
From Genome Similarity Track
Location :
Scaffold_66:6096- 7772
Sequence
1676 bases(100 bases per row)
ACCTTGCGTTGATTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTAGGGGACAGGGACTAGCTTCTCCCCCTACCCTCCTAATCAAGGGAAAAGAGTAAGTTTGGCCTCTCCTCTTCTACTCCGGGAG
GAGAGTGAGGATTATATGCTTCCTCCGTAGGAAGCACGGGCCACTTCAAGCGAGACTCCCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGT
CCTCAAGGGTCGCTGGCAGAAAGCAGGATCCCGGGGACAGGGGAGCGCAGGGAGACAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTG
ATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGG
ATGTGTACGGGGGTACGATCACCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAACAGCAACAAG
TTGTCCGAAGCTTTGCGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCAGG
CAGTTGAAGACTTTGACAGCCTCGACCAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCCTGGGCATGCCCTGGCTTGAGGAGCACGAGCCCT
GGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGAACCCGGGGCGC
CCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCGATGATGTTTTGATGGGGGCCGCGCCCAGA
AGAGGCGCCGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAG
TGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCATAACTGAAGAGGAAGACATCGGATACGCTTCCTGTGTGAGTAACACAGTGCCACACGCGAGTCG
CCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGGCCACGAGTGCCTCGGATGTCGTAGCGACG
ACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGCCGTCGGCAAAGACACCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACG
TCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGACGGGTTTACCCGTCAAG
GCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCGGAGATACTGAACCTCGAGGAAATGACGACTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAG
AGATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGGTGAGAA