Description :
From Genome Similarity Track
Location :
Scaffold_19:60949- 65216
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_19-snap-gene-0.62Di-N-acetylchitobiase
Pytir_DAOMBR486maker-pir_contig_19-snap-gene-0.41Conserved gene of unknown function

Sequence
4267 bases(100 bases per row)
AGTGCCTGCCACATCGCCTGCGTTTCGTGCGCACGCGCCCCATCACCATCGTCATCAGCACCATCGTCATCGGCATTGGACGCATAGTCGAGCGTGTCAG
CGTTCCACATACCGGCTCCACGCAGCCCCAGCTCCTTCACAAGCTGGTACTTCAACGTCAGACTGTGCGGGTTGTCAAACCAGATCTGGAACGACCCGTT
CTTGCTCACCACAAACGGTGACTGCGTCATCTCGTCCCATTGCATAGGGAGCTTCTCGCGCGCGATGAGCGTCTCAATATCCCCAAAGTTCACTTGCGCG
CCGGCGGCATCGCTGCAGGGAGCCCCAAAGAAAGAAGTCTGTTCGTGAACATAAAAGGGCGGTTAGTACATAAAAATGGCTGTGACTAAATAGCTACAAC
CTGTGATGGTAAGTCTTGGATTTCGAGACGTACCGGTTCTAATAAACAGAATTGACTGCCAACGTTTGCGCACGTGTACTTGTAGCCGTACCACGGGACC
CCGAGCACGAGCTTCTCGGGGGCAACGCCGAAGCCAAAAATGAACTCTTCGAGTCCTTGCTTCACGAGAGCCAGCGGTGAGTTCGCTGCTGCGAGGCACT
GATAGTAGATCTGACTGCGCATGTCGTACTGTAAAGTTTGTACAATCCATGTGTCGTTAGCATTGGTTCGACATCCACAAAAACTATGGTGCAGATACGC
ACCGACATGACAAAGAGGAAATCCACCGCGTCTGCGAGCTCTTTCCACTGGTAATAGCGTCCGTCGACTCCACGCGGCGCCCACGACACGTCAAACGTGA
TCTGTATCAAACGAAAATATACGTGAGACACATGTATGCGTACTGAACTTGCTGGTATAGTATCGTACCTGCGCGTGTTGAGTGAAAGCATGCTGCAGTA
GTTCCTGGCGCAATTCCTGGACGAGTGTGGTCATGCACTTGGCCGCGTCTCCGTGCATCGCCTTCTCCGTGTCGATGTTCACGCCGTCCGCATAATTGTT
CACAATGCGTCCATAGGTTTTCTACAGCACATTAAGGAAGGTGTTGTCAACGGAGACGAGTAAGTCAAGAGTGCGCATTGATTAATAGTATTCACTCACT
ACATGCGTTGTACCTGGATCCACTGCTTCCGGAATTGCGGGTCACACAGCGTCTCAACGTCGTCAAAGTTGTGCTTGATCACGACCTTCACACCCTTGCT
GTGTGCATGGCAGAGCAGCTCCTTGTCTTCATTCCAGGCGACAGTGGTCAGCTGGTTGTAAGCATATAGGACAATCCGCCAGCATCGTTAGTGCATACGG
TTGCCAAGTCATAGAGCAGCTACCTCATACATACATGAATATATACAAGCGCGCATTGTACCTGCTCCCAGTCGTAGCGCTTCCACTGATCTGTCGTCGT
CACAGAGAACGCGAACACCTCCTTCTTGCGAGAGTCCTCTCGTTGAGAAGCAGCCGTTGCTCCCGTGCCAGCGACAGGAAGACACTGCTCCTGCTTCTCA
CACGGACATGCGCGCAGCGCTGAGCGCTCGAACGCGTTCAGCAGCTGCAGTGGGAACCTGTGTGGCACGTACACGGAGGCGTGCACGATGTGACCAGCGA
GCAGCAGACACAGCAGCAGCAGCGGCAGCGGCAGCGGCAGATGCCATCGGAACAACTCCATTTTGATTCTCTCGTTCTTTGAAAATGGATCGAAATCAGA
TGTGTTGCTAAGCTGGTACACTGTACCATTTGAGCGTATGCGACACACTGTACCGAGCTCGTATTATTGGGCAACATGTTAAAGATATGTCGACTTTATG
ACCAATGAGCGATCGAATCTCTTCGCGTCGTTTCGCGACCCACCAAACGGTGGTGGCAAATGCGAACGAATCACCCAATGACTGAGTGAATGGGACCAAC
ATGCTAATCTTTCTTTTTGCGCTTCCAGATTCCAGAACCTGCTGCTGATCCGCTCAACGGAAAAGCTCACACGCTCACTCTCTTCTGGCTACGTAACGAC
GTAAACAACCACGCGAGGATGGCGTCCAAGAGCTTGCTCATGAGCATGGGCACTGTCAACATGTGGGGCTACTCACCCGGCTTCGACATGCTGCAAGGCA
TTCCTGCGCTCAAGCCAGCCGACAAAGAGTCTTGTGAGTCCACGACCAGCAGTGAAGGCGCTAAGGCTGGTGCTGGGGGTAGTGATGTGGCTGAGTCAGA
GGCTGAGCCGATCAACCTCCTGCTAATCGGACCCGGGGACATCCGCCATGCGCTCGCGTCGATCGCGCATCGACGCCGCCACGACAGAGTGAGACCCGTG
CACATTTACATCTACGAGAAGCCGATTGAAGCACTTGCGAGGCATTTACTGCTGCTACAAATCGCGCAGGACTGGCAGCTGCCGCTGCGCCAGCGGTGCA
ATCTCTTTCTCGAAGTGTTCGGCAACGCGCGCGTGCAGGTACGATGCTAACATTATTGGCAATGAAGGTGCCGTAGGAGTCCATTCTAAAAAGCTTGCTT
CCTCGGTGTTAGGAGCGCACGAGTGCGTACATTGAAGAGAAGGCGAAGGTTCTGATCGATTTGCTGCACAACGAGCGCGGGATGCTGGCAGATCAGCTGG
ACCTCTCGCATTTGAAGATGCGCCACCGCGACGAGCTCATCGACACATTCAAGAGCTGGTTCCAGAAAGTGCAATTCGATGGTAAAGTGATCGAAGGATG
GGATGTCAGCTATAGTTTATGAAAACCCTGACTTTCTCCTATTGCTCTCTGTTATTTGTACGTACGTATCAGTCGACAAACTTCGCGACCACCGCCTGCG
CCACTTCTACGAAGTGCGCTATGACTACCGCAATAACCTCATCGACTGGGACTACACAGTGAGCTTCTGAGCCAATGTATCTGTCAGACTTGTGCTATGC
AGGGTTTAGCTATCTGATGATGGATCTGTTCCTATGCGAACCTGTAGATGAACCTCAAGAAGATCGAGAACGCGAGTGTGATCCACATCAAACAGTTCCG
CGAGTGGCGCAACTCGGGCGTCGCGTACGAGTTCGGCGACCAGAGCTACACGGAGCCAAACCGTACGATGGCTTCCTACACCGAGGTATGATTTGAATGA
GTGATTCTATTGCGGTTGCTTGTATTACACCAGGCACTGACATTTTCAACGTGCAGGCTCGAAAGAAGCACCACGGCTCAGTGCTCTGTCGTGGACTCTG
GGCGGACGTGGTGATCGGCCCGTACCTCTCATTCGGCGTGAAATGTGACTCGACATACAAGTTCGCGCAGCAGCTCTTTGAAATCCACAACAAAGGCACG
GGCGTCGAGCAGAACCGACACGTACGCCAGTAGTTCTATTCACCTGGTACTTTGCTCCTTTTGAATACTGACTTAAGGATTGTGCTTCACTGGTGCAGAA
TACTACGGAGGTCGCGGTGTTCAACGTACTCTCGTACTTGTACGAACTCGAGACCGGCGAGCCCTACACGATAAAAAAAGCGCACGACGTGTACAGCGGC
ATTGGTGAGTCGGAGCTCGACCAGAGAGCTCAGGGTCCTGCCAACCAGAGCTCCGAGGATTCGTGTCCAAAGATCGTGGAACTACTCGACGAAGACAATG
ACGACGACTCAAACCAGGAAGCCGAGGATAAAGCCTCTGAGAAGTGAGCGTTAGGTTACCCAAGTGTGGCTATTGCGTTATCTGTCAAGTACTGACATTG
TTATGGTACTTTGTCATCACAGAGATCTGTTCAAGCAGCGCGCCAAGGAGAACGACGCACGACAGCGAGCGCAGATCATCTACGAGACGTTCGAGGGCGT
GAAGATCATCCCGCTGACCGGTGAACTCGAAGATCTCTACGTGAAGAAACGCTACACCCGCAAGTTTGACCACGTCTTCCTCTCGACGCAGCACAGCCAC
ACGCTGCAGAAAGCCGATGATGAGAAGGCTGACGACTACCAGACCAAGCGTTTCACCAACCTCTTGGCTGATACTGCGGCTGTGAGCATCGAGTCGTCCG
TGTACGTGCCTAGTTGAGCTTACCACCCTTGAGCGATAGAGTGCCAAGGTACTAAAAGTCTCACTATGAAAATTGGTTGGGCGATGCGTTTTTCCTATAC
AGGTTCTTGCTTCCGCTGAAAGAGGACCAGCGCGTGCTCTACATCTCCAAGCTGCTCGAGATGACGCAAGCCCACGCGCTCAAACCCTCCTTCAAGTTTG
CAAACGGCAGCGGACCGTCACAAGAGGACCTGAGCAAAATCGACACGGCGGTGCTTCGATTCGATTA