Description :
From Genome Similarity Track
Location :
Scaffold_6:60947- 63116
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_02344predicted protein putative
Sappa_CBS223.65SPRG_02345Hypothetical protein

Sequence
2169 bases(100 bases per row)
TGCTGCATAGGCGTGGTGATGACGAAGATCTAGGTGGCTCTGTGCTCAGTCTTTCATGGACGACACGAGTGGGCGCGACTCATCTCGATACATATAGACC
CAGCTCAAATCAAAGACCTAAGCATGCACGAGCAAAAGCATGTTGCACTAAATGTAGTAGTATTGCCTCTAGAGCGATTCAACTAGCTCTTCGAGCTCCA
CTGTATTGCGATCGCAACAGACGCGGGTTTGATCGTAGCAGGTTCTCGTCATACTAGTACCGTTCCGTGCCGTTGGCATCGCTGTCGCTCATGGAATGCT
TCCAGCGCGAGCCAAACACTTATCGCGGACTTTAACCCATTCAACTCTTCTCGTGAGAGCGCAATCAATGTGCAGCACTCGTGCCGGCTCGCGTCTTGCA
TCTTGGCCATGTCGTCCAACAACAGCTTCGCGACGACGTGTTCTGCATACTACTACATGCTACGCCGTCAGGCACCCAGGAAGGCAGCCTCTGTGTCTTG
CTCGGCGCTGAAGGAGCACGGAGCTGCATGACCCAAGGGTCAGGCTCGCGTCTGTGCTGGCGTCGATGAAACGGTTCTAAACAGATGGTTTTCACAAATG
TGTTTAAAACACGCTGAAACGGTGTTGGATTCGATATTTTGCCGCGCTGGAGTTTGAGCGACGGGGCGACCTCGTTTCTACGGCCTCGGCCTCTTCGTGC
GCTATCTTCGAACTCATTTTCCATTTCGCTCGGTACCGCAGACGCCCAGCCTCAGCATGCGCAGCTACGTCGCCTCCGTCGTCGCCTGCCTCGCGGCCAG
CGCCGCCGGTCACTCGTGGATCGAATGCACCGACTACCGCATGGCGGCGCCCGACCAGCCATGGGACCCGACGCTCTGCAAGGGCCGCCCGCGCTGCAGC
GAGCGCCAGACGGCCGCGGGCTTTGGCGTCGATACAGGCATGAACATCGAGAAGAAGCAGTGCCAATGCGCCTACGGCTCGGACGCCGGCAAGGCGATCC
CGACAGCGACGTACACGCCTGGGCAGCGCGTCTGCCTCGCGTACCCGCCAAAGACCCACGTCGCGGATACGTGCACGGGCGCGTTCATCCCGGACCAAGA
GACGATCATTTCGCGGACGGCTCTCGGCGCCACGACCGACGACTTCAGCGGAAAGACGTACGAGCACCTCAATGGCAAGCACGTCGACGGTACGATCGAC
CACAAGGGTTTCCAGAACTGCCAAAACTTTTGCGCCGACAAGGACAAGGCGCTCTGTACCATGTGCTTTGACCTCGAAGCCGACATTGCGCCCGGCAAGT
ACAGCTTCAAGTGGGAGTGGGAGTTCAACAAAGGTCAATTCTTTACGACATGCTGGGAAGCGGCCGTGGCGCGACGCCTGTCGCCGCGGTTGCCACGACG
GCTGCCCCGCCTGTCCCCGTTGCGTCGTCCAACTCGACACCTGTGACGAGCGCCGTGCCAGCGGCGCCCTCTCCACAGCCGTCGACTTCGCTCGCACCAA
ACGCGACGCCATCCACGACGTCCCGCGCATGCGAACATTTGAAACAGGCCGCTCTCGCCATGCAGTGCCCCGCCATTTGAGCGCCTTGTTCAGCTGTCCT
ACTCGTCTACTATAAGCCTATCTAAATACCACCGCCGAAGTGTTGTACACCGTGACAGTCGAGTCTTCAGCTACGTTGCAACGCCCGTTTTGAGCTCGTA
ACGTCGGTTCCGCATGGAGCCGCCGGACGACTATGTCCCGTCTGGCGTCGCGATTCCAGTACGTTGAATGCATTGCTATACCATTGACCACAGCCCTCTA
GATATGCGTGTACACGGCCAGCGCATCTTCTGCGGCCAGCGGTGCGCACCTTGAGCCCACTCCTCGGCTCGCTCGTAATGCCACCGTGTAGAGCCTTGCG
CACTCGAGGTGACTTCGTCCAAGCAGATCACCGTGACCGCCAAGGTTCTTCTGTCGTTTATGTGTCGAATAGAAAAGCACGGGCGCTATGTAGACTGGGT
CGTCGAGTCTCCGCGCCGACCATGCGCTGCAAACGCCGACGGCCGACGACATTGTGCGCCAGTCGATGCAGCCGCTTCTGGAAGCCGTGGTCAACGGGAT
CCACGGGTGCATTCTCTGTGGCGGCAGCGCGCTCTCGCCGCACGTGGCGATATTCCAAGGCGACGAGAC