Description :
From Genome Similarity Track
Location :
scaffold_98:6094- 8264
Transcript NameFunction/comments
Plaha_PHALS_00571myosin-like protein

Sequence
2170 bases(100 bases per row)
CAGGAGCGCGGTGTTATATTCCTGACAATGACGTTGCGTGGCTTCCTGTTTATGTTGAGTCTGTAGATGAAGACGCACGTCTTGTGACTGTCCGGATTCA
ACGGCCACGACCAGAGTGTCCAATGGATCATGACGATAGTGACCGAAGTGGCGAAGTGCGTGTTGTGGCCTTGTCAACTGGGTTTCcattgcaaaatgca
aaactTTCACGCCACATCCAAGGTGTTGCAAATATGATTGATTTAAATCATTTGCACGAAGCGGCTATTCTTCGTAATTTACGAAAACGCTTTCATTCCC
GACTGCCGTATACGTATACAGGCGACATTTGTTTGGCCGTGAATCCGTACCAATGGCTTGATGAGCTTTATACTCCTCGATTGCATACACAGTATCTTGA
GGCACGTACACGACAGGAACTTCCCCCGCATGTGTACGCAGTATCCGTTGCAGCATTTAAACATATGTGCGAACACAGTCAAAATCAGAGTATACTTGTT
AGTGGTGAATCAGGTGCAGGGAAGACAGAGACGACAAAAATATTAATGGATAATCTTGCAATGATtgcatcatcatcttcgACAACAAAAGGTGCTGATG
ACAGTATCACAAGTCGAATTATTCAAGTTAATCCGTTGCTTGAGAGTTTTGGCAATGCAAAAACCACACGCAATGACAATTCGAGTCGATTTGGCAAATT
CACGCAACTTCAATTTGATGCAAATGCGAAACTTTGTGGCGCCCAATGTGAAACGTACTTATTGGAAAAGACACGAGTGATTAGTCATGAACGAGGTGAG
CGCAATTATCATATTTTCTACCAATTACTACACGGTACGACGGAAGCTGAAAGTGATGCCATGGGATTGGGTCCGAATGGCCCAAAATTTGGCTATTTAC
AAGAAAAAGAGCCGCAAAATGTGAATCGACATGGACGAAAGATAAAAAGCGATGAAGTGGAGCCTGTTAAGCCTCAAGCTGTGCAAGAAGCCGAAATTGC
GAAAGATCGCGCGCGATTTGCCAAGACACGCGAAGCTTTGACGTTACTTGGACTTACGCCAGAGCAACAAATTGGGCTATTTCATGTTTTATCTGGTATC
TTACATTTAGGTGAAGCCCAATTTGTGACGAAAATTGAGAATGATGAAGCGTGTGACCTTGTCATGGATTCGGTGGTTTATTCAAGTTTACTGCTTGGGT
TAGATCCTGAGATGATGGCCACTGCTTTAACCCATCGTACAATGAAAGCTGCGGGTGACGTGTATCGTGTCCCACTTACCGTTGACCAAGCGCTGTCAGG
ACGAGATGCACTCGCCAAAGCAATTTATGCCAGTATTTTTGATTGGTTGGTGGCAGGAATAAATGCAAGTTTAGGGGCTGCATGTCAAGTGACTCGTACC
ACAATTGGGGTTTTGGATATTTTTGGGTTTGAAAGTTTTCAGTACAATTCATTTGAACAACTTTGTATCAATTATGCAAATGAAAAGTTGCAAGAAAAAT
TTACTCAAGATGTTTTTCGTGCGGTGGAAGAAGAATATGAACGAGAAGAAATTACATGGGCACATATTGCATATGCTGATAATTCGGATACACTTGCATT
AATTGATGGACGAATGGGTATTTTGGCTTTATTAAATGAAGAAATTGTACGACCTCGTGGAAATGAAGAAGGTTTTGTGAATAAACTTGCAAGTGCATAT
TTAAAACAAAAACAATTGATTGATTTTCCACGAACAAGTAAAACGCAATTTGCAATTCATCATTATGCTGGGACTGTTTTATATGAAGCCATGGGGTTTT
TAGACAAACATAAAGACGCACTTTTGTCAGATCTGTCCGAATTAATGTGTCATAGTCATGAATCGTTGCCACAAATGCTTTTTAAAGCTAAAGCTGAAAT
GGAAGCAGCTGAAAGTAAACGTTTAAGCTCAAGTTTACGTAAAAGTGGTGGCAATGGAGCGGAGAAGACAGTTGGAATGCAATTTAAACAATCGTTAACT
TCACTTATGACGACAATTAGCACTACAAATGTGAATTATATTCGATGTATTAAACCTAATAGCAGCAAAAGCTCAATAGAGTTAGAAGACAAGATGGTTG
CAAATCAATTACGATGTGCTGGTGTGATTGAAGCGATTTGTATTGCTCGAGCAGGATATCCGAATCGTCT