Description :
From Genome Similarity Track
Location :
scaffold_457:6093- 10214
Transcript NameFunction/comments
g8529.t1 phospholipid-transporting ATPase, putative

Sequence
4121 bases(100 bases per row)
GAGTTGCGCATGGCTGTCGAGATGGCGTCCGAGCGCGGCAACGAGTTGGACGCGATGTACGACTCGGCTAATGTCGTCTCCTCATCGCAGCTGAAGGCGT
AGCCCGTGTTGCGACGGCCAGTTGTCGGCCGGAACATCTTGGTCGGCACTCGCTCCCACGTGGCATCCTCCGAGATGGATTCGCTGAACACACTGGCGGA
ATAGCTTTCAGTGACACCTGAGCTCACAGAAGTGTGCGAGCGAGGCACAGAGGTACCAGCAGCACTGGAAACGCTCTTCTTCGGTTGCTCGTACAGCGTT
GCTGCGAAGCTCTGGTGGTGCTGAGCCTTGAGGATCTCGGCGTCGGAGTGGCCAAAGTCGCTCAGGTAACCGGTGGTGTGGACGTCGTCTAAAGACATGG
ACAGTGTCTGCTCCTCCATGTGGTTGATGGTCAAGCGGCGCTGGTACTTGCGCTGTGAACCTCCACCCATGGATTCCTGCAGAAGTTGAGCCAGGTCAGG
GTGGAATGTTCGTTGGTACAGGTTGTAGGCGATGTGACGTCCAAGTGCCAATGAGCAGCCCATGATGAGAACGAGGAAGTAGCCCCACGTCTTGAAAGTG
GGAGCGAATGCACCGAACTCGTCGTAGCCCACCTTGAACGTTGCGAAGTACGGCGTCTCCGTTCCAATAGCAGCGAAGCAGAACCACGACATGACACTGC
CTAGCCAGAGAGAGAACGACAGAATCGTCCAGCGATCTGCGATCATCCAGATCTTGATGTTCACGATCAGCACCGTCAACGAAAACGCCACCATACCGAA
CTCCACACGAGACTCGCTGCCTGCTGCCTTCTCCGAAGCGTTAAAGCCGTAAGACATCACCACAAAGATGATGAGTGACTCGTAAAATGCGGCGGCGATC
CAGCGGGCGAACGTGTACATGTTGAAGAAGAAACGCTCCGGGCCGCGGCGGTACAAGTCCGGGTACTCGATACTGAACGGGGCCGGTAAGTCCTTATCCA
GAACACCCACCACAACGATAGGCAGACCTGTGAATGCCACGTTGTACAGCTGAACACCGATTTCCCAGTACATCTTGGAGCCTGAGGCGCCCGAGAGGTA
TCCGTACCAGTACTGCGCCAGCACAAGCGTGATGTTCTTGTAGAACATGTAGAGCACAAGCTTGGAGATACGAATGTAGTTCCAACGTCCGTGAACCAGA
AGCAGTCGCTCTAGGAAACGGAACTGCGCAATGGCGTAGTCGCTCGAGTTCACAGCCTGCATACCTTCCTGTCCAGAGATACCGACACCGACGTGAGCGG
CCTGAATCATCGCGACATCGTTGGCACCATCGCCGATAGCAAGCGTCCGCACAGTCTTGATATTGTCCCTGACAAGCTTCACCATCTCGGCCTTCTGCGC
AGGCGACACGCGGTTGCAGATCACTGCACGGCACAACTTCGCAAACGACAGAAGGTGAGGCGCAGTTCCCGGACGGAGAGCCATCTCTAAAGCTTCGCCG
TCGATAATCAACGAGATTTCCTTCTCGGCTCCTCCAGCCATGCCCTTCGCACTGTCGATAAACTCACGGGCTGCGGCATTTAGCTTTGCACGGATTGCTG
CTTCATCTGGACATGTGGTAGCGTTCACAATGACTTGGGTGATGGAGTTGTCGAGCAACGAGCAGGCATAAGAGATGTTGATAGCTGTCTCCTCTTTGTC
GCCTGTGAGCATCCACACCTTGATACCCGCGCGCGTCAGGTTAGCCAGACACTGGGGAACGCCATCCTGCAGCTTGTCTTCAATGGCTGTCGCGCCAATA
AGCTCCAGACCTTCTTCAATTTCTTCCATGAGGTCATCGATAGCGTTTGGCTTACCGTCTTTTCGACGGTCAATCTCAGCCACGTTACCCTGTGCATCAT
CGAAGCGCATCTTCCACTGCTGGAACCAGCGTTCATCCAGTGGTTTCATTGCAAGCGCCAATGTACGTAAACCATCGTCAGCATACTTCTCCATGTGATC
ACGTGTGATGTTCTTGAGCTTCTGCATTGCAGGGTCATCCTTCAAGCGCTGATAAATCATCATGTCGGCCCCCTTTGTGTACAGCAGCAGCTCTCCGGTT
GGCTTGCGAACCACGACAGACATGCGCTTACGCGTACTGTTAAATTCGAGGACATCCAGCACTTCGTAGGTCACACGCTGTCCCAGGACCTCCACCATCG
CCGTTCCAACGCTACGGCTTTCAAACTTGAACCCAGCAAAGGCTGCACCAGCCACAAGTGCCTGCTCATCTGGAGACGATGCCGACAAGCGAACTTCTCC
AGACTCCAGTTTCTCAGGGATCACTGTGTGGCACACGGCAAGGTGCTCGAAGAACTGCATAATCTTCTCCTTCTGCTCCTCACCAGCACTGCCCTTCATT
CCGTCGAACAGCGCCTTGTCCACGAAATTCACAAACGGAATCCTCTTGATGCTCGGGTCCAACTTAGGCTCCGGGGGGATTGGTTTTCCAGCACGAACCA
ATGCAGCACGACCGATTTCCGTGATACCCGAGCCATAAGAAATGCCATTGATGGAGCACTTGCGGAACTCCATGACGTTGCACGTAAGCGTTCCCGTCTT
GTCGCTGAAAACGTACGAGATCTGGCCCAGCTCTTCGTTCAGCTCCATCGTCCGCACAATAGCAGGGGTGTCCGTCTCAGCATGGTACATCTCAAGATCC
CACGACATGAAGCGCGACTGCAGGAACTTGACACTCGTCATGGACACGTAAAGAGAGATGGGGATGACCTGATAGAGCAGCAAGAAGTAGTAGAACATCA
TCTGGATGAAGGCCACGAAGCGTGAACGGTTCCTCTCCGCCTCCGAGAGCTCAATATACCACGTATTGCGCACGATGTCGTACTGCCACGTGATGTAGCA
GGTAGCGGCCATAGCGCAAGCCACAAACAGCCCCAAGCACAAAATGACGATCATGCGGTTGATGTTCAGCATCAGGTCGCTCCACTTGGACGGCGCACCA
CTGGCACTTTGCATAATCTTCGTATCGTTTCCGGTGTTGAGCACAATGCCGAAGATCCAGTCTGTGTTACGCAAGTTGCAGCCTCGTAACAGCACGTTCT
TAACTGACAGCGGCATCACCTCCACGCCGCAGCCGTCACCGACAGTGACTTCCACTTTACCTGCGAACTTGTTGATGTGCGGGTTGGGCTGCTCGCATTT
GATGACACCGCGCAAGAGCGCCAACTCCGCTGCGTTTGAGAGCGAGTTCATGGTCGCCGCTACAGCCTGCCGCAGCTTCAAGTTCGTTTCTCCATCCAGA
CTCTTGGTTTCAACGTAGCAAATGCCGCTGGGCGGTTCACCTACAGGCTCCGCCACAGCGAGGACAAGTACGTCCGCAGGGATCACTTCTCTGTTACGGA
TCTGCAAGAAGTCTCCGACCTTGATGTCTGCCCACTTCCTGTCAACGACCGCTCCGTCCTGAATCACATGGCACGTAGCCGAGTTGGCTTCGTTGTCCGA
CTTGTGACGTCTCAAGTCCTCCATGACGGCGAACACTGCGTCAATGGAGATGACGAAGAACAGCACCGGAGCGTTCGTTGGGTAGCCGTACGTGTTACTG
ATGCTAGGGATGCTCTGCAGCACGCAGACCATGAGGAAGAAGAAATTGGCCACCTTGGTGAAACTCTCCTTCAAGAACTTGGGCAGGAACGTCACGGTGT
TGTACTTGGACGTCACCACGACGTTCGAGCACTTGTCGAACACCGCATTCCCCGGCGCGTAGTTAAAATAGACTTCTCTCAGCGCTTCGTCGTGTCCTGC
TGCCTGTCCTGATCCTGAATGAATACTGCCTGCCGTAGAGGCCGGCGTCTGCTGCGCTGCATAGCCCACGAGTTCGTCCTCGTCCAGGATCTGCTCGGCG
CCTCCTTTTCTGCTCTTGTGTCGAACCTGCCGAGGAGACTGGAGCAGTGCGGGACTGCCCAAAGTGTTGTAACCACTGGTGCTCGAGCCTAAAACGTTGT
CACTTTGGTCCGACAGTGCGGAATCGTCTCTAGTGGGGGCCACACTAGAACAGAGCGCGACCGAGTCGTCCTCCACGCGCGAACCGCGGAAAACCCGCGA
CGAGCTGCGCTTGGCCGCCAT