Description :
From Genome Similarity Track
Location :
Scaffold_138:60921- 63592
Transcript NameFunction/comments
Phyta_totarag4377hypothetical protein PHYSODRAFT_504907
Phyta_totarag4378hypothetical protein PHYSODRAFT_505690

Sequence
2671 bases(100 bases per row)
TATCACAAATTTAAATGACATCTTTTACGGACTATTTTCTGCGCCTCAGAATTTGGTCATTCTATCGGGATGGCATCTCTTCTGCTCCGGTCGTGGGGCT
CGACGCGTGCAGGCGCCAACTGTCGCTCCCTGAGCGTATTGAGTGGCATCTCGGAAGATTTACTAGTGAGCACTAGCATTGGGCACCAAATCGGAGGCGG
CTCGCACTCTGCGTTGGTGGACAGTTTGGTCCGGACGAATGTGGTGGCTGCAGGCTCGCGactggaggcggcgctgaGGCGTGTGGACCGTGGAGACTTC
GTGGCGCCGGCATTCCGAGACTCGAGCGAGCGATATGCCAACCGTCCATTGAAGATTGGCTCTGTAGCTACTATCTCCACTCCGCAGCAACACGCGCATG
TGCTGGGGCTGTTGGAGCCGCACCTTCAGCCAGGGATGACGGCGGTGGACGTGGGCTGCGGCTCGGGGGTACTCGTGGCTGCTATGGCGCACTTGGTGGG
GCCGTTTGGTTCTGTCATGGGTGTCGATATTGTCCCGGAGCTTGTGAAGTTTTCGAAAGAGAATTTGCAACGCAGTCTGGGCAAGGAAGCAACAGACAAG
CAGACGAAGATCATTCTGAGCACTGGGAAAAAAGACCTTGGTCTGCCGTCTGATGGTCGGTATGATTGTATCCATGTCGGTGTTGCTGTGGAGACCAAGG
CTGAAGCGGAGAGCTTCTTGGAGTACCTCAAACCTGGTGGTGGACTCTTGATCCCGCTcggcggtgctggcgctgagcagaagctggtcaAGGTGAGAAG
TACTTTGTAGGCGAAATAAGGAACAGCTTGCAGTCAGCTGACGTGTTGTTTTTCCGTGATGTACAGATGACGAAGCTTGCTGATGGAACTGTGGACAAGC
GGGACATCATGAGCGTTCTTTGCCAGCCTATGTTAGACAGCGTGCCCGTGAAGATTGTCCAAGAGACTCGCGCTGAAAAGTTGGAGCGGGTGGAAAAGGC
TCTCACGCAGTGGCGCGAGGATTTTGAAGCCAAGAATGGACGGAAACCCACCCGAGACGATCTCATGGGTAACGCCGCCTCGAAAAAGCTGTTTCAAGAG
TTTGCGGCACTAAGAAAGTAGACGAAAGGACTGCGTGAGCTCAAGTTTTCGATTTCACTCATCAAGCTAGAGTCCGATGCTCATTTTCTTCACACGAGGT
GGCATTGTCTTGTCACGCATGCGCCGCTGCCTTGGTTTTCTGCAGGAGTTGCTCCGCGAGGTGGATCTGGTGGGTAATGTGCTCGCGCTGCGTCATTTTG
GCATAGCGAGGCGGGTTTTCAGATGTCACAAACGCCGCAAGTGGCTCCACGACCGTGTCACCATTGGCCCCGTTAAAACGCACAATAGACTGACGCTTTT
TCTCCGAGTTGCACACACGATGCTGCGCCGCACAAACACGACACGTAACTATGTTAGAAATAACATACATGAATTTCTCCAAATGTTGCGTAGTAGATTT
TACCTCGGTCGCAACAAGAACACCATTCGTCCAGTGCTCGAGCATGTCGCCAACCATGACGAAGAGCCTGTCATAAGAAAAGAAAAGCTGGTCACACGAT
AGATTCCTGGTTCAAGCTGATCACAAGCGTCCGTTACCTGTCATCACATACGGGAGCTTCGACCCAAACGCCCTGGCGATTCAGCAAGTGCAAGCCTTCT
CCGTTCTGGTGGATGATAGTGAAGCATTCGAAATCCGTGTGTGAGGCAATCCCTACTGTAGAGTTCTTCACGGTGGCATCGGTCTCTGGATACGTCAGCA
GTCGCATGAATGCCTCGGCCTCTTCGTCCACATGTTGCTGCAAATCCCCAAACAGCAACGTGAGTACAACCTTATCCAAAAGTACAAGTACGATAGAAGA
TACGTCGTACGTACTAGGAACGTGTTGACCGGCAGTCCGAGCATCTCGGCAAAGCTCTGGAATAACACCGTCGAGAGTTTGCTAGTCTCCTCATACAGTG
CGTACACGTCCTCGCGAAAGCGTGGGACTTCAGCTGGCCAAACATTTGGACCCAGGCTcgccgcctccttcacgtACGTCTCGGGGAGCTCCCGGGCGAG
GTCGAAGCCTTCCAAGTGCGAAACCACATCGGGTTGGTACTGCACCATCCAATAAAAGTAACCGCAATCAGTATCATTCCACCAAACCAtcacatacatg
tagcaaatGCAAACTCCGTCGCACCGATGGCTCCTCAAACATCGGCGTCCAGCCTCGAGCATTGGGCGAGCGTTTGCAATGATACTTTTGCTTGACAGCG
TCAGGCAGTGCGATGAACTCGTCGGCTCGACGGTACGCCTCCTGGATGAGCTGGCTGGGCAGCACTCCTTCCGTAGGGACCGTGAAGAAACCCGTCTCGA
TGCAGGCAGAGCGCATGGCATCCAGGAcctgcgtcttggtctcgGGTGACACGTTGCGACCACCGTTAGCAGCAGCCACTAGCGGGGAAACGTCCACGAG
AGGCAACTGCTGCGGCACCACCTTAGCCGCCGTCATCACTCgcggcgacgagaagcgtCTGGCGCCCAGTGCCACTTGAGACGAAGACCGAAGACGTGCA
CACATGGTGATTCGCAGAGTGCTGAATTTCGCCCGACATCACTTTAGCTTCAACATGATGTGGTGTACATT