Description :
From Genome Similarity Track
Location :
Scaffold_1015:6091- 10819
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1015-fgenesh-gene-0.2Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_1015-snap-gene-0.6Chaperone

Sequence
4728 bases(100 bases per row)
ATTATCGACCTCTTTCGCTTCCATGCTGTATGGTGATCTGGTAGTAGTCTTGTCAGCCTCCATGTCCACATCATCGTCGTCGTCCATGTCATCATCGCCA
AGCGACTGCGTATCTGGAAACGAGTCAATCGAGTCCCGTCGACCGTAGTCGTACGCATCACCTTCCTCTTCTTTTCTGCCTTCGTGGCTGTTAAAGAGAA
GTTCGGTCTCGACGTCTGCAGGATCTGTCGTGGGCTCGAACTGGTACTGAATAGGAGAGCTCAGAGGCGAGTTCGCGATACTCGTTTCTCTGAAACTGGC
AAATCCCGGATACTCGACAGTATCGTCTTCTTGTTCTGTTACCAGCGGCGGTGTTGCCATATCTCGAATAAATTGAGGACCACGTTCAAACTCCTCACCA
CCCGACGATTTATAACTCTTGATTCCAACTGTCTTGTGGAGATCGCTTGCGTTCTCTGTCGCATTTGCCCTTTTCTTCACTGGTGAACCGCTCTGCAATG
GATCACTGGTCGTCTTCTCGGATGTGTCGCTCGCACTATTCTTCTGCTTGCGCTTGTTCAATTCGTTTTCTATAGAAAACAAGAATGCTCCTGCGAGAGA
GCGCTGCATGCCTCTGTATTCACTACCTCCGATGACAAAAATTGGCTCTGGTTTCGCTTTGATCGCTGTTGTTGTCGGTGCTGAAATAATAGCATCCGGC
GACATCCTTTGTGGCTCTCGATGCTGCTCCTCTAGGTCATCTTGCGTGTCTCCACAGAAAAACTCTGCATAATTCTGTTGACTGTAGCTCGAGTCCTGGC
TCAACTGCGAAACAGATACTCTCTGAGGCCGGAAATCGCGCTGCTTTGTGATAGAGCTTAGGTCCAACGCGAGTCGCATCTGCCGCTTGCCATTCTCGTC
TCGTGTGTCTGTGTCACCATCATGCGACTGTATTCGCGCCCGGAAGCCTGGGAATGCAGCCAGATCCGCGCTGCACTGCATACTGCTGACGGATTCATCC
AGCTCAAACATGTCGGTATTGCGGTCTCCATCTGCATCTTCATGCTCGTCCTCTTCGTCCACGTTTCTTCTGCTGGTGGCTGTTGTTCTCTCAATGGTGA
CGGCAGCACTCACCGCGGCACGCTCATTCGCTCCAGACAACAGCATCGCAGGCTTCTTCTTCGTCGTCGTGTGCACAGCAGTTCTGTGGTCCTCTGGAGG
CGAGAGCGCCGTCAGGTTCGTGAGCAGATCCATTTCCATCGCACGCTCTTGTTCTTGTTCTTGTTCGTGTTCTTCTCTCTCAGCTGATCAGTGGCTCGCA
GAGATGGCGCTAGTGTTAAGGGTACTTCGCAGTGAAAACACACTCACACAGTGGTGCAGACGCGATGTGGACACGACGCAGGCAAGAAGGCAATCACACG
CATGCACACACGCACACACGCAGCGAGAGCCCTGATTACTGTTGTGCTTGCTGTTTGTTGGCGCCACTTGCTCTTTTTGGAGTTGCTCGTTGCCGCCAAA
AACAAAATGATCGGAATGAAGGTCATCGAGGTCGTATATCTTCGACGCCGAAAGTACGGTGTCAGTTTCCTCGCTTGAAGTAGTTTCATTCACTTTGTGT
TACTAACTTCAAAATCAGAATTATCGTTTTCATATCAGGATATTAACCGTTTTCAATAGTAATCTTGAGCCGAAACATGATACAATATTATCTGTTCATG
ATTGATGCGGCGTCCTTTCACGACAGTTGATCGTGCCTATCCTCAACCCAACGACAGACAGCAACAAAAGCGGCAAATGCGTCATTTCCAGATATATCAG
CCAGCAGCGAAGCAGAATACAGCATCCGCGAAGATGCTGCACGCAGTAGCGGAAGCGCTGCATCTCACTGGTGTAAGCGATTCTACCATCGAAGGAGAAA
GCGTCGCAGGCACCAACACCCCTCACTGGAGTGAATTGACAGAGCGCGACGCGCAGCGCCTCGTCGCTGTTGGGCTACAGCTCAATCCAAATCCAGAAGT
TGCAGTTGCTGCTGTAAGTGCAGCAAGTGCTCAAGCGGCGCAGCGTGTGCGAGGCCAATTTTGCTTCCAGTACATCCGTCCGTGGGAGTGTGAGCCTCCA
GTGCAGGTGCTGCGCCTGCGAGAGGAAATACAGAGACAGTCGCGTCCGCGTTCTCACTCGCTAGACTCACCGGCGATTGGCACTTCAGCATCAGCAACGG
CAGTGGTCCACCCGCGTACTGGGGACTCGAAGAGACGTCGAAGCTTCTTGTCGGCTCTCCAGTCGCCGCTGCGAGCGCGCAGTACCAGTGCTGTATCTGA
ACGTGAGGATGGTCCAAGCAGCCGTCAAATTGCAACGGTATCCGAGCAGTCGACTCTATCAACAGCCGCAAGCCCGCGATGCAAGGTTGAGGTCTTGACG
CCTTCGATATTTGCCTTGGTAGAGCAGACCGCAGTACAGCGTGTCCCCGCGTTGCAACAGCAGCAATCGCAGCCACCGCAACAACAACAGATTCTCCGAA
CTCCTGAGCCGATTATGACAGGCAAGCGCAAGCGAGCGAGCGTGACGATCTCGCCTCCTGCACTTCCGCAGGCTCCGCGCGTATCGCAAGCTGCTGCAAT
GCCGTCAGTGCGCTCTTCTTCGCGATGGGTGTCGCCAAAACCAGAGCGGTTGCTGCGTCAACAACAGCAAACGCCTCGAGAGCAGCACCAGCAACAACTG
CAAGCTGAAGAGCCCCAGCAACCACCGCTAAAGACCAGGAGACTGAGTGAAAGCGGAGCGAGAACTCCCTCGATGGCATCACGTTTTGCCTCGACGTTGC
GAGAATTCTTCAAGGAGATGTGTGGCAATGGCAGCGAAGATACTGACCCAAGTGACGAAGTCGGTGGTCATGAAAGCGGTGGTGAGAGTGGGCCAGGTGA
CGATGCCAGTGATCGCGAGAGCGACGCTGAGAGTGATGCGAGCGAGACTTCAAGCACAAGCAGCACATGGAGTAGCTCTTGCGACAGCAGCAGCAATGTT
GTAGGTGATAGAGAGTTTGGTGACTGCGACCAATACGGGGGCAATGCGACGCTGCTCGCAGACATCCAAGATGTGCTTGAGCCTGTGTGGAGTCTACTCG
AGACCACGTCCAGCCGTTTTCAGCGCTTCGTTGTGTGGGGAGAAGGAGCCCGCGATCTGCCATCGTCCTCTACGCGCAGTCCCCCACTCGCACAGAAGAG
CAAGTTTGGCAGCTGTCAATCTATTGATGCCATTGCTGGGATTGTTACGACCACCGAGCTGGCCTTTGACGGAGCCGAGTTTGAAGATGAGAATAGCGAG
ATTGAATGGACGAATGCCATTGAGAAGCCGGACAAGCTCGCGGTGCGCACGAGACGCCAGTGCAGGGAGATGCGGCAGCTTAGTACCGCCTGGAGGCTCT
GGTAAGTGAACTAACAGTTGACATTGCGGAAATTGGTTCACTAAAGATAGCTGCCTGCACGACAAATATACAAATATACATGCGCATTGACCATTGACAT
TCCTTGGCATTCCTGCACTAGCTCAATCCATTTACCAAGCAGAGAGAAAGAGCAAGCAAGCGACGACGGCATGGCGCTGAACATCGAGCCTCCTGTGGTC
GTTATGAACGACGTGATGGCAGAAGAGGAAGCCGCACTCCTGACCGAGTTCCGCAGTAAACCGCCGACCGAAGTCAAGATCTCACTCAACGGCTGCGAGA
GTCCGTACTACCTGTCCGAGTGCAACTGCGTGCTCTCGTTCAAGAAAGGGCGGTACGCGGAGAGCAAATGCGAGGCGCACAAGCTCACGCTACGCAACTC
ACGACCGCATCCAGAGCCACTGGGCAGTCCGATCCAGGATCCTAGCAACGATACCACGACGCCCACGCATCGCTTCTTGGCGTCTCCGAGTCGAACGGCG
CTCATAGCATTGTCGACTTCGCATCTTGCGGGTTCTCATCAGGGTGGTAGCACAGTGCCTTTGAGTTCGCCGAGCAAGATCAAGGCAATGATGAAAGAGT
CCAAGAGCACCAGCGCCTTGCCACAACGGAGCAGCGAGTTCATTGAGCTGGAGAAAGAGGGGTGTCGAGTACCGAGTAGCGTTGGTTTGCTGCCGTCGCT
GTCCACGCCCATGCTGCTGCATTTGTCGCCCGCAAATTCTCCGGCTTCATTAGCAGCAGGGAATCACTGGAGCCCAAGTGCCAAGCTCAGCAGCTCTTCT
CACGTAAGTGCTGCCTGAAGCAGTTGAACTATGTGAATGGATGACCTAGACTACCTAGACTGACAAGACTCTTTGTGTGGGGATGGTGCTAGGCGTTCTC
ACTGAGTTCCATTACGATGAATGCGGAGCCGTCGAGCCTGGTGCTAAAGGAAGCGATGGAAATGCTTGACAAATACAACAAGATCCTCCGCCTACACGCT
GAGTCGCCTCGCAACCTGGCGATTTTGTACACGCGGCGGTCGACTCTGCTCGCGGCCTTGGGGAGATACGAGGAAGCGCTCCGAGACGCTGAGCAGTCGA
TCCAGCTGGATCCGAAAGCTACTGTGGTGAGGCGCACAACTGGGGGCTATTCTACCGATGCAAGATAGACATGGCGATGAAGAAACTAGACTTTGTTTCG
TATTTCTCTGTGTGTGTTGACTGTGAAGGGATATTTTCGCAAGGGCTTTGTATTGTGTGGGCTCCGAAGGTTCGCAGACGCGACGAGCGCGTTTCAGCAT
GGACTGGCGCATGACATCAACTGCCGCG