Description :
From Genome Similarity Track
Location :
Scaffold_6:60908- 63117
Transcript NameFunction/comments
Sapdi_VS20SDRG_02510hypothetical protein
Sapdi_VS20SDRG_02511adenosinetriphosphatase

Sequence
2209 bases(100 bases per row)
CGCTCACATCTTTTCCACAAAGAGACCTGTCTCGCTCGACACCTTGACTGCGTCGCCGGCTTCAATGTTGCCCGGCACTTGGATCGTACTGCCGTTGGTC
AAAGTCGCCTCCTTGTTGTCCACGCCAAGCGTGACGATCGACTGTGCATACATAAGTAAGTGCGTCACGACCATGCGACGGATTGCACGTAGTACCTCGA
CGTTGAGCGTAACAAAGTCGGGCATGGTGAGCCAAAGCGGGACGCCCTCGACAATCTGCAGCGCCACGGTCATGCCTTCGTTCAAGACAATCATCTGCTT
GTCGTTGAGGAGCTCCGTCGACACTTCAATCTAAAGCAGCGAGCGAGGTGAGCGGCGCCGCCAGCGATGCACGCGCACCTGCTCAAAGGTCTCGGGCTGC
ATGAGCACGAGCTTGCTGCCGTCTTGGTACAAGAACTGGAACGGCTGGTCCTTCGTGAGCGGCGCCTTCTTGACGCTCTCGGAGGACCGGAAGCGGCGGT
TGATCTTGGTGCCCGTCACAATGTCGCGGAGCTCCGCCTGCATGTAGGCAACACCCTTGCCCGGCTTGACCGACTGGCTCTTCACGACGCGGTACAGCTT
GCCTTCGATCTCGACAGCGACGCCCGGGCGCACCTGGTTGCCGCTGATGTGGCTGTGGCGCGTCAGCGGCCGCGCCAGCGTCAAGCACGCGCGACGAAAC
ATGTTGGTTTTTGACCATCGGTGCACTTTCCGGTGGCGCCGGATAAACCACCGGAATTACCCAGGAGGTTTGCCCCAATGTCCCAAGAACGCGTGAGAGC
TCGAGCTTGTCGTGCGGTGCGAGTGGAGCGACCAATCGATCGATCTACCCTCGCGATGACCGTCCCGACACAACGCATGCACATGTAGTGGCATAGTACG
CTGTTTGCTTGACGTTGCTGCCGAGCATCTCGACAAGGTGCAGGGTTGTCGCTGCAGTTGAGACTAACCGGTTCTGCCCACAATATTTTGCCCATATCCC
ACGTGGGACATTTGGGACAAATGCCCCGTCGACGTTGCGTGTTTGTAGTCACGTGCAAACTGGATCGGAATTGCCATGCATCTCTTTGGCTTTGGTCGAC
GGTCCTCGACGCCGCCGGAGCCCGAGGACGCGCGCATGGCGGCGCTTCGGAGCCTTGCGACGAGCGCAGTGGCTGCAGACGAGGCGCACGCATACGCCGA
GGCGCTCGAGCTCTACACGCGTCTCATCCAGCGCATGCTGGAGTTGCTGCCAGGTATTTAGGCCTTGTCGATGGATAAAGTTGTTCCATCCCTCGTCGTA
GGCGTACCCGACCAAGGCAGCTGGAAGAAGAAGATCGAGGGCTACATCACAAGAGCCGAGCAGGTCAAGGCCCTAGCAGTGCCGCCGCCGCCGACCACGT
CCAGCCTCGTTGCGCAGAATGACCCGTACGCGCACATGATTCTCGACGAGGTGCTGGACAAGTCACCCGGCGTGCACTGGGACGACATTGCAGGACTGAG
CTTCGCCAAGCAGACGCTTCAAGTGCTACATTCTCTGACGTATCAAGTTGTGGGGCTCAGGCGACCCTAGGAAGCAATTGTGTTGCCGACGCTTCGACCC
GATCTTTTTACAGGTGACGAGCACACGCTACTACTACCGACAGCTCATGCCCCGCACCTAGGTCTTTGCAGTCCACCCAAAGGCGCGCTGCTCTTTGGCC
CGCCGGGGACTGGTTCGTAGGACTTGACACTATGTCATCGCTAGCATCGTACCACTACTAGGCAAGACAATGCTGGCCAAGGCGATTGCGACCGAGGCCA
AGGCGACGTTCTTCTCGTACCGGGCTTTTTCTACCTCAATATGTATACCTTTGGGATTAGCATCACGGCATCGACGCTCACGTCCAAGTGGATGGGCGAA
GGTGAGAAGCTCGTGCGCGCGCTCTTCGAGATGGCGCGCGAGTTGCAGCCGTCCGTCATCTTTATGGACGAAATCGATGCGGTGCTCTCGGCCCGCGCCG
GCGCCAGCGAACACGAAGCCAGTCGCCGCCTCAAGAATCAAGTTGATACATTGCCGCATGGCGGTGTCTCACACACGAGTAGTTTCTCGTGCAAATGGAC
GGGGTTGCCTCCAGGAGCGCCGACCGCGTGCTCGTTCTTGGCGCTACGAACCTTCCATTCGAGCTCGACGAGGCGCTGCTGCGCCGGCTGGAAAAACGTA
TTTACGGTA